Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402328521:

Variant ID: vg0402328521 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 2328521
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTCGTATTCATGTAATCTGGGAGAAATATGTAATAAAAACAAGTTCTATGAGGACTCTTTCAGAAGATGCCGATATGGGATCAGGTGTATAATTGTTTAC[T/G]
GTCGAAGGAAACCTAGGGTCTCATTTCAGAGGAACTATGTTCTAACCTCGAGTTAATAACCAACCTGATGATAGAAAAGAAAATGCCGAGTCCGGGAAGA

Reverse complement sequence

TCTTCCCGGACTCGGCATTTTCTTTTCTATCATCAGGTTGGTTATTAACTCGAGGTTAGAACATAGTTCCTCTGAAATGAGACCCTAGGTTTCCTTCGAC[A/C]
GTAAACAATTATACACCTGATCCCATATCGGCATCTTCTGAAAGAGTCCTCATAGAACTTGTTTTTATTACATATTTCTCCCAGATTACATGAATACGAG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.40%	0.30%	3.39%	15.98%	NA
All Indica	2759	86.10%	0.40%	3.52%	9.97%	NA
All Japonica	1512	67.10%	0.10%	3.44%	29.37%	NA
Aus	269	99.30%	0.00%	0.37%	0.37%	NA
Indica I	595	95.00%	0.20%	1.85%	3.03%	NA
Indica II	465	73.30%	0.90%	4.09%	21.72%	NA
Indica III	913	85.50%	0.40%	5.26%	8.76%	NA
Indica Intermediate	786	87.50%	0.40%	2.42%	9.67%	NA
Temperate Japonica	767	79.10%	0.00%	3.13%	17.73%	NA
Tropical Japonica	504	52.60%	0.20%	2.98%	44.25%	NA
Japonica Intermediate	241	59.30%	0.00%	5.39%	35.27%	NA
VI/Aromatic	96	68.80%	0.00%	7.29%	23.96%	NA
Intermediate	90	83.30%	0.00%	3.33%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0402328521	T -> DEL	N	N	silent_mutation	Average:43.51; most accessible tissue: Zhenshan97 flag leaf, score: 70.007	N	N	N	N
vg0402328521	T -> G	LOC_Os04g04840.1	upstream_gene_variant ; 126.0bp to feature; MODIFIER	silent_mutation	Average:43.51; most accessible tissue: Zhenshan97 flag leaf, score: 70.007	N	N	N	N
vg0402328521	T -> G	LOC_Os04g04830.1	downstream_gene_variant ; 279.0bp to feature; MODIFIER	silent_mutation	Average:43.51; most accessible tissue: Zhenshan97 flag leaf, score: 70.007	N	N	N	N
vg0402328521	T -> G	LOC_Os04g04830-LOC_Os04g04840	intergenic_region ; MODIFIER	silent_mutation	Average:43.51; most accessible tissue: Zhenshan97 flag leaf, score: 70.007	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0402328521	NA	4.20E-06	mr1218	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402328521	NA	1.89E-07	mr1583	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402328521	NA	2.08E-06	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251