\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402283132:

Variant ID: vg0402283132 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 2283132
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.65, C: 0.33, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


ACCCATAGCAATTCCGGATCAACAAATAAAGTAAAAAAATTGCAAAGGGATAAACAGGTGGAGAAACGGATGTGCATCGTGCACACGATGTCCAGCGCAG[T/C]
GCATCCCAGCCGTTAAAATTCGACTGTACTCAGCCACATAATGTGGCGACACTTTTTCAGCAAATCCATCTTAGTTTCGGTAGAACCGAAATTTCGGGAT

Reverse complement sequence

ATCCCGAAATTTCGGTTCTACCGAAACTAAGATGGATTTGCTGAAAAAGTGTCGCCACATTATGTGGCTGAGTACAGTCGAATTTTAACGGCTGGGATGC[A/G]
CTGCGCTGGACATCGTGTGCACGATGCACATCCGTTTCTCCACCTGTTTATCCCTTTGCAATTTTTTTACTTTATTTGTTGATCCGGAATTGCTATGGGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.50% 3.60% 0.83% 56.05% NA
All Indica  2759 25.00% 0.50% 0.69% 73.72% NA
All Japonica  1512 58.70% 10.10% 0.07% 31.15% NA
Aus  269 81.40% 0.40% 6.69% 11.52% NA
Indica I  595 6.20% 0.00% 0.67% 93.11% NA
Indica II  465 5.20% 0.00% 0.65% 94.19% NA
Indica III  913 46.90% 1.40% 0.00% 51.70% NA
Indica Intermediate  786 25.70% 0.30% 1.53% 72.52% NA
Temperate Japonica  767 88.00% 3.70% 0.00% 8.34% NA
Tropical Japonica  504 29.20% 7.70% 0.20% 62.90% NA
Japonica Intermediate  241 27.40% 35.30% 0.00% 37.34% NA
VI/Aromatic  96 28.10% 0.00% 0.00% 71.88% NA
Intermediate  90 47.80% 2.20% 1.11% 48.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0402283132 T -> C LOC_Os04g04740.1 downstream_gene_variant ; 3563.0bp to feature; MODIFIER silent_mutation Average:36.43; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0402283132 T -> C LOC_Os04g04750.1 intron_variant ; MODIFIER silent_mutation Average:36.43; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0402283132 T -> DEL N N silent_mutation Average:36.43; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0402283132 NA 1.99E-06 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402283132 NA 1.02E-06 mr1054 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402283132 NA 1.86E-10 mr1108 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402283132 NA 9.95E-09 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402283132 NA 2.57E-09 mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402283132 NA 4.65E-07 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402283132 NA 7.97E-07 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402283132 NA 6.76E-16 mr1147 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402283132 NA 3.55E-08 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402283132 NA 3.53E-11 mr1229 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402283132 NA 1.72E-08 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402283132 NA 8.77E-09 mr1234 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402283132 NA 1.12E-08 mr1237 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402283132 NA 9.51E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402283132 NA 1.83E-07 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402283132 NA 3.89E-06 mr1287 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402283132 NA 1.37E-06 mr1358 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402283132 NA 2.57E-06 mr1372 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402283132 NA 3.18E-10 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402283132 NA 1.05E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402283132 NA 9.98E-06 mr1440 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402283132 NA 2.63E-06 mr1500 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402283132 NA 5.93E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402283132 NA 1.58E-09 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402283132 NA 4.09E-06 mr1568 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402283132 NA 9.80E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402283132 NA 6.17E-07 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402283132 NA 1.85E-06 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402283132 NA 1.06E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402283132 NA 1.60E-09 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402283132 NA 2.30E-08 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402283132 NA 1.32E-06 mr1872 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402283132 NA 4.83E-07 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402283132 NA 7.49E-07 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402283132 NA 6.69E-08 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402283132 NA 1.09E-08 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251