\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402263913:

Variant ID: vg0402263913 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 2263913
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


AAGAATATGCTTTTCGATATCCTCGTTCCTTTCTCCAGCGATCACTTAAATAGTCTTACAAAAGGGTAAGGACCACATTCATCGTGGCCTCAGTTTCAGA[T/C]
AGCTGTTTACATAACTAAGTTCAGGAAAACGACAATGATTACATTAACAGTGGCCACCGACAAAGATGGACGGCCAGATGATGTTCATACCGCTTTGCTC

Reverse complement sequence

GAGCAAAGCGGTATGAACATCATCTGGCCGTCCATCTTTGTCGGTGGCCACTGTTAATGTAATCATTGTCGTTTTCCTGAACTTAGTTATGTAAACAGCT[A/G]
TCTGAAACTGAGGCCACGATGAATGTGGTCCTTACCCTTTTGTAAGACTATTTAAGTGATCGCTGGAGAAAGGAACGAGGATATCGAAAAGCATATTCTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 29.30% 13.80% 0.28% 56.67% NA
All Indica  2759 23.30% 2.10% 0.33% 74.19% NA
All Japonica  1512 30.80% 37.90% 0.13% 31.22% NA
Aus  269 78.80% 2.60% 0.74% 17.84% NA
Indica I  595 3.40% 2.50% 0.50% 93.61% NA
Indica II  465 3.20% 1.70% 0.22% 94.84% NA
Indica III  913 47.50% 0.20% 0.11% 52.14% NA
Indica Intermediate  786 22.30% 4.30% 0.51% 72.90% NA
Temperate Japonica  767 24.00% 67.30% 0.13% 8.60% NA
Tropical Japonica  504 33.30% 3.60% 0.20% 62.90% NA
Japonica Intermediate  241 46.90% 16.20% 0.00% 36.93% NA
VI/Aromatic  96 28.10% 0.00% 0.00% 71.88% NA
Intermediate  90 38.90% 14.40% 0.00% 46.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0402263913 T -> C LOC_Os04g04700.1 upstream_gene_variant ; 3551.0bp to feature; MODIFIER silent_mutation Average:6.183; most accessible tissue: Callus, score: 16.674 N N N N
vg0402263913 T -> C LOC_Os04g04710.1 upstream_gene_variant ; 539.0bp to feature; MODIFIER silent_mutation Average:6.183; most accessible tissue: Callus, score: 16.674 N N N N
vg0402263913 T -> C LOC_Os04g04720.1 upstream_gene_variant ; 2971.0bp to feature; MODIFIER silent_mutation Average:6.183; most accessible tissue: Callus, score: 16.674 N N N N
vg0402263913 T -> C LOC_Os04g04710-LOC_Os04g04720 intergenic_region ; MODIFIER silent_mutation Average:6.183; most accessible tissue: Callus, score: 16.674 N N N N
vg0402263913 T -> DEL N N silent_mutation Average:6.183; most accessible tissue: Callus, score: 16.674 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0402263913 3.30E-06 NA mr1067 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402263913 NA 2.32E-06 mr1100 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402263913 NA 1.22E-09 mr1108 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402263913 NA 5.73E-07 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402263913 NA 2.15E-08 mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402263913 NA 6.89E-07 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402263913 NA 1.37E-07 mr1777 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251