\
| Variant ID: vg0402263913 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 2263913 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 82. )
AAGAATATGCTTTTCGATATCCTCGTTCCTTTCTCCAGCGATCACTTAAATAGTCTTACAAAAGGGTAAGGACCACATTCATCGTGGCCTCAGTTTCAGA[T/C]
AGCTGTTTACATAACTAAGTTCAGGAAAACGACAATGATTACATTAACAGTGGCCACCGACAAAGATGGACGGCCAGATGATGTTCATACCGCTTTGCTC
GAGCAAAGCGGTATGAACATCATCTGGCCGTCCATCTTTGTCGGTGGCCACTGTTAATGTAATCATTGTCGTTTTCCTGAACTTAGTTATGTAAACAGCT[A/G]
TCTGAAACTGAGGCCACGATGAATGTGGTCCTTACCCTTTTGTAAGACTATTTAAGTGATCGCTGGAGAAAGGAACGAGGATATCGAAAAGCATATTCTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 29.30% | 13.80% | 0.28% | 56.67% | NA |
| All Indica | 2759 | 23.30% | 2.10% | 0.33% | 74.19% | NA |
| All Japonica | 1512 | 30.80% | 37.90% | 0.13% | 31.22% | NA |
| Aus | 269 | 78.80% | 2.60% | 0.74% | 17.84% | NA |
| Indica I | 595 | 3.40% | 2.50% | 0.50% | 93.61% | NA |
| Indica II | 465 | 3.20% | 1.70% | 0.22% | 94.84% | NA |
| Indica III | 913 | 47.50% | 0.20% | 0.11% | 52.14% | NA |
| Indica Intermediate | 786 | 22.30% | 4.30% | 0.51% | 72.90% | NA |
| Temperate Japonica | 767 | 24.00% | 67.30% | 0.13% | 8.60% | NA |
| Tropical Japonica | 504 | 33.30% | 3.60% | 0.20% | 62.90% | NA |
| Japonica Intermediate | 241 | 46.90% | 16.20% | 0.00% | 36.93% | NA |
| VI/Aromatic | 96 | 28.10% | 0.00% | 0.00% | 71.88% | NA |
| Intermediate | 90 | 38.90% | 14.40% | 0.00% | 46.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0402263913 | T -> C | LOC_Os04g04700.1 | upstream_gene_variant ; 3551.0bp to feature; MODIFIER | silent_mutation | Average:6.183; most accessible tissue: Callus, score: 16.674 | N | N | N | N |
| vg0402263913 | T -> C | LOC_Os04g04710.1 | upstream_gene_variant ; 539.0bp to feature; MODIFIER | silent_mutation | Average:6.183; most accessible tissue: Callus, score: 16.674 | N | N | N | N |
| vg0402263913 | T -> C | LOC_Os04g04720.1 | upstream_gene_variant ; 2971.0bp to feature; MODIFIER | silent_mutation | Average:6.183; most accessible tissue: Callus, score: 16.674 | N | N | N | N |
| vg0402263913 | T -> C | LOC_Os04g04710-LOC_Os04g04720 | intergenic_region ; MODIFIER | silent_mutation | Average:6.183; most accessible tissue: Callus, score: 16.674 | N | N | N | N |
| vg0402263913 | T -> DEL | N | N | silent_mutation | Average:6.183; most accessible tissue: Callus, score: 16.674 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0402263913 | 3.30E-06 | NA | mr1067 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402263913 | NA | 2.32E-06 | mr1100 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402263913 | NA | 1.22E-09 | mr1108 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402263913 | NA | 5.73E-07 | mr1111 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402263913 | NA | 2.15E-08 | mr1112 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402263913 | NA | 6.89E-07 | mr1286 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402263913 | NA | 1.37E-07 | mr1777 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |