Search for Variation information by Variation ID:
Detailed information for vg0402261971:
| Variant ID: vg0402261971 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 2261971 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 99. )
Flanking Sequence (100 bp) in Reference Genome:
GGACATTGGTTGCGTATAGCATACTCCTGATCCATGAATATACTAGTGCTCCCACTATCGACCAGCCCAACATCTCTTTTCCCATTGATGAGGATTATCA[C/T]
TGAAAATGTATCAGGTCTGGTAGTCCCCTGCATGGCATTCTGTGAGACATACATTAGCTCCTCAGTCTCCAAATCTCTGGAGTTTTCTATGGGATTTCTT
Reverse complement sequence
AAGAAATCCCATAGAAAACTCCAGAGATTTGGAGACTGAGGAGCTAATGTATGTCTCACAGAATGCCATGCAGGGGACTACCAGACCTGATACATTTTCA[G/A]
TGATAATCCTCATCAATGGGAAAAGAGATGTTGGGCTGGTCGATAGTGGGAGCACTAGTATATTCATGGATCAGGAGTATGCTATACGCAACCAATGTCC
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 45.00% | 20.70% | 21.03% | 13.35% | NA |
| All Indica | 2759 | 26.10% | 33.30% | 31.17% | 9.42% | NA |
| All Japonica | 1512 | 69.80% | 1.70% | 5.29% | 23.21% | NA |
| Aus | 269 | 81.80% | 5.90% | 10.04% | 2.23% | NA |
| Indica I | 595 | 8.70% | 33.80% | 47.39% | 10.08% | NA |
| Indica II | 465 | 5.80% | 44.10% | 38.49% | 11.61% | NA |
| Indica III | 913 | 47.20% | 26.80% | 16.87% | 9.09% | NA |
| Indica Intermediate | 786 | 26.70% | 34.10% | 31.17% | 8.02% | NA |
| Temperate Japonica | 767 | 92.30% | 0.00% | 0.91% | 6.78% | NA |
| Tropical Japonica | 504 | 38.50% | 3.80% | 11.31% | 46.43% | NA |
| Japonica Intermediate | 241 | 63.90% | 2.50% | 6.64% | 26.97% | NA |
| VI/Aromatic | 96 | 83.30% | 6.20% | 4.17% | 6.25% | NA |
| Intermediate | 90 | 54.40% | 11.10% | 25.56% | 8.89% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0402261971 | C -> DEL | LOC_Os04g04710.1 | N | frameshift_variant | Average:10.147; most accessible tissue: Callus, score: 53.289 | N | N | N | N |
| vg0402261971 | C -> T | LOC_Os04g04710.1 | missense_variant ; p.Val389Met; MODERATE | nonsynonymous_codon ; V389M | Average:10.147; most accessible tissue: Callus, score: 53.289 | benign  |
0.749 |
TOLERATED | 0.09 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0402261971 | 1.26E-06 | NA | mr1016 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402261971 | 9.17E-06 | NA | mr1019 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402261971 | 5.76E-06 | NA | mr1055 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402261971 | 3.42E-06 | NA | mr1055_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402261971 | 9.25E-06 | NA | mr1490_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |