Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402256940:

Variant ID: vg0402256940 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 2256940
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.69, C: 0.31, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:

GACCTAAAAGTAGATGGTTGCACGTAAACCAGAATTTAGATAGATTCAGGTCCTCTAAATAAAAGGTAATACACTACTTATGTTTGGGGATTGTATTCAT[T/C]
TGGTGTAGTATTGATCTGACAATTTAATTATGGCGATCTTGGTCATGCCCTTGGAGGGCTCCCTACCTGCTTGGGGCTTGGGTTACAAAAGGAGAAATAG

Reverse complement sequence

CTATTTCTCCTTTTGTAACCCAAGCCCCAAGCAGGTAGGGAGCCCTCCAAGGGCATGACCAAGATCGCCATAATTAAATTGTCAGATCAATACTACACCA[A/G]
ATGAATACAATCCCCAAACATAAGTAGTGTATTACCTTTTATTTAGAGGACCTGAATCTATCTAAATTCTGGTTTACGTGCAACCATCTACTTTTAGGTC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.80%	7.00%	1.16%	55.08%	NA
All Indica	2759	14.50%	11.60%	1.49%	72.42%	NA
All Japonica	1512	69.20%	0.30%	0.73%	29.76%	NA
Aus	269	81.80%	0.40%	0.74%	17.10%	NA
Indica I	595	6.20%	2.40%	3.36%	88.07%	NA
Indica II	465	4.50%	1.50%	0.86%	93.12%	NA
Indica III	913	25.20%	22.60%	0.99%	51.26%	NA
Indica Intermediate	786	14.10%	12.00%	1.02%	72.90%	NA
Temperate Japonica	767	92.00%	0.00%	0.52%	7.43%	NA
Tropical Japonica	504	37.70%	0.60%	0.99%	60.71%	NA
Japonica Intermediate	241	62.70%	0.40%	0.83%	36.10%	NA
VI/Aromatic	96	29.20%	0.00%	0.00%	70.83%	NA
Intermediate	90	48.90%	4.40%	1.11%	45.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0402256940	T -> C	LOC_Os04g04670.1	upstream_gene_variant ; 4690.0bp to feature; MODIFIER	silent_mutation	Average:13.017; most accessible tissue: Callus, score: 75.155	N	N	N	N
vg0402256940	T -> C	LOC_Os04g04690.1	upstream_gene_variant ; 304.0bp to feature; MODIFIER	silent_mutation	Average:13.017; most accessible tissue: Callus, score: 75.155	N	N	N	N
vg0402256940	T -> C	LOC_Os04g04680.1	downstream_gene_variant ; 2427.0bp to feature; MODIFIER	silent_mutation	Average:13.017; most accessible tissue: Callus, score: 75.155	N	N	N	N
vg0402256940	T -> C	LOC_Os04g04700.1	downstream_gene_variant ; 1726.0bp to feature; MODIFIER	silent_mutation	Average:13.017; most accessible tissue: Callus, score: 75.155	N	N	N	N
vg0402256940	T -> C	LOC_Os04g04710.1	downstream_gene_variant ; 3624.0bp to feature; MODIFIER	silent_mutation	Average:13.017; most accessible tissue: Callus, score: 75.155	N	N	N	N
vg0402256940	T -> C	LOC_Os04g04690-LOC_Os04g04700	intergenic_region ; MODIFIER	silent_mutation	Average:13.017; most accessible tissue: Callus, score: 75.155	N	N	N	N
vg0402256940	T -> DEL	N	N	silent_mutation	Average:13.017; most accessible tissue: Callus, score: 75.155	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0402256940	NA	5.01E-06	mr1117	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402256940	3.62E-06	3.62E-06	mr1240	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402256940	NA	9.12E-06	mr1320	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251