Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402256940:

Variant ID: vg0402256940 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 2256940
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.69, C: 0.31, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


GACCTAAAAGTAGATGGTTGCACGTAAACCAGAATTTAGATAGATTCAGGTCCTCTAAATAAAAGGTAATACACTACTTATGTTTGGGGATTGTATTCAT[T/C]
TGGTGTAGTATTGATCTGACAATTTAATTATGGCGATCTTGGTCATGCCCTTGGAGGGCTCCCTACCTGCTTGGGGCTTGGGTTACAAAAGGAGAAATAG

Reverse complement sequence

CTATTTCTCCTTTTGTAACCCAAGCCCCAAGCAGGTAGGGAGCCCTCCAAGGGCATGACCAAGATCGCCATAATTAAATTGTCAGATCAATACTACACCA[A/G]
ATGAATACAATCCCCAAACATAAGTAGTGTATTACCTTTTATTTAGAGGACCTGAATCTATCTAAATTCTGGTTTACGTGCAACCATCTACTTTTAGGTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.80% 7.00% 1.16% 55.08% NA
All Indica  2759 14.50% 11.60% 1.49% 72.42% NA
All Japonica  1512 69.20% 0.30% 0.73% 29.76% NA
Aus  269 81.80% 0.40% 0.74% 17.10% NA
Indica I  595 6.20% 2.40% 3.36% 88.07% NA
Indica II  465 4.50% 1.50% 0.86% 93.12% NA
Indica III  913 25.20% 22.60% 0.99% 51.26% NA
Indica Intermediate  786 14.10% 12.00% 1.02% 72.90% NA
Temperate Japonica  767 92.00% 0.00% 0.52% 7.43% NA
Tropical Japonica  504 37.70% 0.60% 0.99% 60.71% NA
Japonica Intermediate  241 62.70% 0.40% 0.83% 36.10% NA
VI/Aromatic  96 29.20% 0.00% 0.00% 70.83% NA
Intermediate  90 48.90% 4.40% 1.11% 45.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0402256940 T -> C LOC_Os04g04670.1 upstream_gene_variant ; 4690.0bp to feature; MODIFIER silent_mutation Average:13.017; most accessible tissue: Callus, score: 75.155 N N N N
vg0402256940 T -> C LOC_Os04g04690.1 upstream_gene_variant ; 304.0bp to feature; MODIFIER silent_mutation Average:13.017; most accessible tissue: Callus, score: 75.155 N N N N
vg0402256940 T -> C LOC_Os04g04680.1 downstream_gene_variant ; 2427.0bp to feature; MODIFIER silent_mutation Average:13.017; most accessible tissue: Callus, score: 75.155 N N N N
vg0402256940 T -> C LOC_Os04g04700.1 downstream_gene_variant ; 1726.0bp to feature; MODIFIER silent_mutation Average:13.017; most accessible tissue: Callus, score: 75.155 N N N N
vg0402256940 T -> C LOC_Os04g04710.1 downstream_gene_variant ; 3624.0bp to feature; MODIFIER silent_mutation Average:13.017; most accessible tissue: Callus, score: 75.155 N N N N
vg0402256940 T -> C LOC_Os04g04690-LOC_Os04g04700 intergenic_region ; MODIFIER silent_mutation Average:13.017; most accessible tissue: Callus, score: 75.155 N N N N
vg0402256940 T -> DEL N N silent_mutation Average:13.017; most accessible tissue: Callus, score: 75.155 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0402256940 NA 5.01E-06 mr1117 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402256940 3.62E-06 3.62E-06 mr1240 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402256940 NA 9.12E-06 mr1320 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251