\
| Variant ID: vg0402256940 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 2256940 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.69, C: 0.31, others allele: 0.00, population size: 84. )
GACCTAAAAGTAGATGGTTGCACGTAAACCAGAATTTAGATAGATTCAGGTCCTCTAAATAAAAGGTAATACACTACTTATGTTTGGGGATTGTATTCAT[T/C]
TGGTGTAGTATTGATCTGACAATTTAATTATGGCGATCTTGGTCATGCCCTTGGAGGGCTCCCTACCTGCTTGGGGCTTGGGTTACAAAAGGAGAAATAG
CTATTTCTCCTTTTGTAACCCAAGCCCCAAGCAGGTAGGGAGCCCTCCAAGGGCATGACCAAGATCGCCATAATTAAATTGTCAGATCAATACTACACCA[A/G]
ATGAATACAATCCCCAAACATAAGTAGTGTATTACCTTTTATTTAGAGGACCTGAATCTATCTAAATTCTGGTTTACGTGCAACCATCTACTTTTAGGTC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.80% | 7.00% | 1.16% | 55.08% | NA |
| All Indica | 2759 | 14.50% | 11.60% | 1.49% | 72.42% | NA |
| All Japonica | 1512 | 69.20% | 0.30% | 0.73% | 29.76% | NA |
| Aus | 269 | 81.80% | 0.40% | 0.74% | 17.10% | NA |
| Indica I | 595 | 6.20% | 2.40% | 3.36% | 88.07% | NA |
| Indica II | 465 | 4.50% | 1.50% | 0.86% | 93.12% | NA |
| Indica III | 913 | 25.20% | 22.60% | 0.99% | 51.26% | NA |
| Indica Intermediate | 786 | 14.10% | 12.00% | 1.02% | 72.90% | NA |
| Temperate Japonica | 767 | 92.00% | 0.00% | 0.52% | 7.43% | NA |
| Tropical Japonica | 504 | 37.70% | 0.60% | 0.99% | 60.71% | NA |
| Japonica Intermediate | 241 | 62.70% | 0.40% | 0.83% | 36.10% | NA |
| VI/Aromatic | 96 | 29.20% | 0.00% | 0.00% | 70.83% | NA |
| Intermediate | 90 | 48.90% | 4.40% | 1.11% | 45.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0402256940 | T -> C | LOC_Os04g04670.1 | upstream_gene_variant ; 4690.0bp to feature; MODIFIER | silent_mutation | Average:13.017; most accessible tissue: Callus, score: 75.155 | N | N | N | N |
| vg0402256940 | T -> C | LOC_Os04g04690.1 | upstream_gene_variant ; 304.0bp to feature; MODIFIER | silent_mutation | Average:13.017; most accessible tissue: Callus, score: 75.155 | N | N | N | N |
| vg0402256940 | T -> C | LOC_Os04g04680.1 | downstream_gene_variant ; 2427.0bp to feature; MODIFIER | silent_mutation | Average:13.017; most accessible tissue: Callus, score: 75.155 | N | N | N | N |
| vg0402256940 | T -> C | LOC_Os04g04700.1 | downstream_gene_variant ; 1726.0bp to feature; MODIFIER | silent_mutation | Average:13.017; most accessible tissue: Callus, score: 75.155 | N | N | N | N |
| vg0402256940 | T -> C | LOC_Os04g04710.1 | downstream_gene_variant ; 3624.0bp to feature; MODIFIER | silent_mutation | Average:13.017; most accessible tissue: Callus, score: 75.155 | N | N | N | N |
| vg0402256940 | T -> C | LOC_Os04g04690-LOC_Os04g04700 | intergenic_region ; MODIFIER | silent_mutation | Average:13.017; most accessible tissue: Callus, score: 75.155 | N | N | N | N |
| vg0402256940 | T -> DEL | N | N | silent_mutation | Average:13.017; most accessible tissue: Callus, score: 75.155 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0402256940 | NA | 5.01E-06 | mr1117 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402256940 | 3.62E-06 | 3.62E-06 | mr1240 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402256940 | NA | 9.12E-06 | mr1320 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |