\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402244708:

Variant ID: vg0402244708 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 2244708
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.81, A: 0.18, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:


GGCAATGCCGGTGCTCCAAGTCCACCGCCTCGCGTCCTCGCGCTCCATCTCCCACAGCCGAGCGTTCACGCTAAAAGTGTGAGCCGAGCTCACCGGCGCC[G/A]
CGTCGCCGTCCTCGCGCCCCTGTCGCCGCCTTCTCCTTCCTTCTCCTTTCGCCAAAACCATGGCCACAAGAGTCGCCATGCCCGCCATCCCCACCTTTCA

Reverse complement sequence

TGAAAGGTGGGGATGGCGGGCATGGCGACTCTTGTGGCCATGGTTTTGGCGAAAGGAGAAGGAAGGAGAAGGCGGCGACAGGGGCGCGAGGACGGCGACG[C/T]
GGCGCCGGTGAGCTCGGCTCACACTTTTAGCGTGAACGCTCGGCTGTGGGAGATGGAGCGCGAGGACGCGAGGCGGTGGACTTGGAGCACCGGCATTGCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.50% 27.10% 0.36% 18.05% NA
All Indica  2759 75.30% 13.60% 0.36% 10.73% NA
All Japonica  1512 14.00% 56.20% 0.40% 29.43% NA
Aus  269 78.10% 6.70% 0.37% 14.87% NA
Indica I  595 93.10% 3.40% 0.17% 3.36% NA
Indica II  465 96.30% 2.80% 0.00% 0.86% NA
Indica III  913 57.20% 23.90% 0.66% 18.29% NA
Indica Intermediate  786 70.40% 15.90% 0.38% 13.36% NA
Temperate Japonica  767 0.90% 88.50% 0.00% 10.56% NA
Tropical Japonica  504 36.70% 22.00% 0.79% 40.48% NA
Japonica Intermediate  241 7.90% 24.90% 0.83% 66.39% NA
VI/Aromatic  96 22.90% 10.40% 0.00% 66.67% NA
Intermediate  90 60.00% 31.10% 0.00% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0402244708 G -> DEL LOC_Os04g04660.1 N frameshift_variant Average:83.683; most accessible tissue: Zhenshan97 young leaf, score: 94.554 N N N N
vg0402244708 G -> A LOC_Os04g04660.1 synonymous_variant ; p.Arg64Arg; LOW synonymous_codon Average:83.683; most accessible tissue: Zhenshan97 young leaf, score: 94.554 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0402244708 G A -0.02 -0.02 -0.02 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0402244708 NA 5.67E-06 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402244708 NA 2.70E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402244708 NA 2.00E-06 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402244708 2.44E-06 NA mr1392 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402244708 NA 4.38E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402244708 NA 7.42E-08 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402244708 NA 2.88E-06 mr1872 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402244708 NA 5.55E-06 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402244708 NA 3.64E-08 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251