\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402229157:

Variant ID: vg0402229157 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 2229157
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGCAGAGGACCAGCGTCTGATATTTCATAAATATCTGTTGATGAAAAAACATACACTGGCCTGAGAGATCCGCTTAACTCTAGTGCAGGTCCAAAGAATC[T/C]
GACTATTGGCGATGTGATAATTCTCTTAAGGGATTACTAAATTTCACTGTTAACAATATCATATGTTCGAGCTATGGCAGCCATGCAGCCTTGTCGTGTT

Reverse complement sequence

AACACGACAAGGCTGCATGGCTGCCATAGCTCGAACATATGATATTGTTAACAGTGAAATTTAGTAATCCCTTAAGAGAATTATCACATCGCCAATAGTC[A/G]
GATTCTTTGGACCTGCACTAGAGTTAAGCGGATCTCTCAGGCCAGTGTATGTTTTTTCATCAACAGATATTTATGAAATATCAGACGCTGGTCCTCTGCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.70% 6.50% 0.95% 11.79% NA
All Indica  2759 80.10% 10.90% 0.47% 8.59% NA
All Japonica  1512 81.30% 0.30% 1.92% 16.47% NA
Aus  269 90.30% 0.00% 0.37% 9.29% NA
Indica I  595 96.60% 1.70% 0.17% 1.51% NA
Indica II  465 97.80% 1.10% 0.22% 0.86% NA
Indica III  913 61.10% 21.70% 0.99% 16.21% NA
Indica Intermediate  786 79.00% 11.10% 0.25% 9.67% NA
Temperate Japonica  767 95.60% 0.10% 1.56% 2.74% NA
Tropical Japonica  504 70.80% 0.60% 1.39% 27.18% NA
Japonica Intermediate  241 57.70% 0.40% 4.15% 37.76% NA
VI/Aromatic  96 54.20% 0.00% 2.08% 43.75% NA
Intermediate  90 91.10% 4.40% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0402229157 T -> C LOC_Os04g04640.1 intron_variant ; MODIFIER silent_mutation Average:57.38; most accessible tissue: Zhenshan97 panicle, score: 91.992 N N N N
vg0402229157 T -> DEL N N silent_mutation Average:57.38; most accessible tissue: Zhenshan97 panicle, score: 91.992 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0402229157 T C -0.01 0.0 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0402229157 1.79E-06 1.63E-07 mr1117 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402229157 9.65E-06 3.72E-06 mr1320 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402229157 NA 1.22E-06 mr1961 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251