\
| Variant ID: vg0402221936 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 2221936 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, G: 0.05, others allele: 0.00, population size: 93. )
GTCATATGTGGAAAGGACTATTTTGTAATATTAAAACACATGAAAGAAAGAGTAGGTACAAACATGAAGGAGTTGTTAGTAAAATATTCTTTTAAAAGGA[G/C]
TAAATAATAGATAGAAATAATTGAAAGCGCATATGAAAATACAGTTGCAGATTTGCTACAAACTCTTCCTATTATTTCTCACATCTTATCATTTTTAAAT
ATTTAAAAATGATAAGATGTGAGAAATAATAGGAAGAGTTTGTAGCAAATCTGCAACTGTATTTTCATATGCGCTTTCAATTATTTCTATCTATTATTTA[C/G]
TCCTTTTAAAAGAATATTTTACTAACAACTCCTTCATGTTTGTACCTACTCTTTCTTTCATGTGTTTTAATATTACAAAATAGTCCTTTCCACATATGAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.20% | 24.50% | 0.63% | 10.66% | NA |
| All Indica | 2759 | 75.80% | 17.50% | 0.29% | 6.42% | NA |
| All Japonica | 1512 | 39.70% | 42.70% | 1.32% | 16.34% | NA |
| Aus | 269 | 85.10% | 3.00% | 0.74% | 11.15% | NA |
| Indica I | 595 | 92.80% | 5.50% | 0.17% | 1.51% | NA |
| Indica II | 465 | 95.70% | 3.00% | 0.22% | 1.08% | NA |
| Indica III | 913 | 58.30% | 31.10% | 0.33% | 10.30% | NA |
| Indica Intermediate | 786 | 71.50% | 19.30% | 0.38% | 8.78% | NA |
| Temperate Japonica | 767 | 31.80% | 63.20% | 2.09% | 2.87% | NA |
| Tropical Japonica | 504 | 59.70% | 13.70% | 0.79% | 25.79% | NA |
| Japonica Intermediate | 241 | 22.80% | 37.80% | 0.00% | 39.42% | NA |
| VI/Aromatic | 96 | 41.70% | 11.50% | 0.00% | 46.88% | NA |
| Intermediate | 90 | 80.00% | 14.40% | 0.00% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0402221936 | G -> C | LOC_Os04g04640.1 | intron_variant ; MODIFIER | silent_mutation | Average:23.366; most accessible tissue: Callus, score: 29.855 | N | N | N | N |
| vg0402221936 | G -> DEL | N | N | silent_mutation | Average:23.366; most accessible tissue: Callus, score: 29.855 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0402221936 | NA | 9.58E-07 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402221936 | NA | 5.22E-12 | mr1182 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402221936 | NA | 4.55E-06 | mr1182 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402221936 | NA | 9.67E-11 | mr1244 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402221936 | NA | 3.26E-06 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402221936 | NA | 4.73E-12 | mr1650 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402221936 | NA | 8.74E-09 | mr1658 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402221936 | NA | 1.15E-06 | mr1708 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402221936 | NA | 9.57E-07 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402221936 | NA | 3.08E-06 | mr1077_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402221936 | NA | 3.05E-07 | mr1229_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402221936 | NA | 1.15E-07 | mr1521_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402221936 | NA | 7.63E-07 | mr1745_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402221936 | NA | 2.92E-08 | mr1880_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |