\
| Variant ID: vg0402217448 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 2217448 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.83, C: 0.17, others allele: 0.00, population size: 54. )
TTAATTAATTACTTGCCAACTAAAACTTGATAATGGTGGGTTGTGGGCACATGGTTTTGAGAGTTGTGCTCATGACAATTAAGTACCGGTTCACGAGTTT[C/T]
GGTTGTGAAACATTAATCGTGCCAACCACAAGCCAGCGTGGGCAACGGCTTTACCTTTTGTATAGCATGGTTTATTGCGGGACACCAGACTGAGAAGTGA
TCACTTCTCAGTCTGGTGTCCCGCAATAAACCATGCTATACAAAAGGTAAAGCCGTTGCCCACGCTGGCTTGTGGTTGGCACGATTAATGTTTCACAACC[G/A]
AAACTCGTGAACCGGTACTTAATTGTCATGAGCACAACTCTCAAAACCATGTGCCCACAACCCACCATTATCAAGTTTTAGTTGGCAAGTAATTAATTAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 33.90% | 17.40% | 19.00% | 29.71% | NA |
| All Indica | 2759 | 54.00% | 3.30% | 24.68% | 17.98% | NA |
| All Japonica | 1512 | 3.50% | 46.00% | 8.80% | 41.73% | NA |
| Aus | 269 | 4.80% | 4.10% | 14.87% | 76.21% | NA |
| Indica I | 595 | 60.00% | 3.50% | 14.62% | 21.85% | NA |
| Indica II | 465 | 60.40% | 3.00% | 14.62% | 21.94% | NA |
| Indica III | 913 | 48.70% | 1.00% | 36.04% | 14.24% | NA |
| Indica Intermediate | 786 | 51.90% | 6.00% | 25.06% | 17.05% | NA |
| Temperate Japonica | 767 | 1.70% | 72.80% | 3.91% | 21.64% | NA |
| Tropical Japonica | 504 | 6.00% | 9.90% | 14.48% | 69.64% | NA |
| Japonica Intermediate | 241 | 4.10% | 36.10% | 12.45% | 47.30% | NA |
| VI/Aromatic | 96 | 11.50% | 11.50% | 28.12% | 48.96% | NA |
| Intermediate | 90 | 40.00% | 13.30% | 18.89% | 27.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0402217448 | C -> DEL | N | N | silent_mutation | Average:14.8; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg0402217448 | C -> T | LOC_Os04g04620.1 | upstream_gene_variant ; 875.0bp to feature; MODIFIER | silent_mutation | Average:14.8; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg0402217448 | C -> T | LOC_Os04g04640.1 | downstream_gene_variant ; 3425.0bp to feature; MODIFIER | silent_mutation | Average:14.8; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg0402217448 | C -> T | LOC_Os04g04620-LOC_Os04g04640 | intergenic_region ; MODIFIER | silent_mutation | Average:14.8; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0402217448 | NA | 3.38E-06 | mr1295_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402217448 | 3.29E-06 | 2.18E-08 | mr1553_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402217448 | 1.27E-07 | 1.27E-07 | mr1574_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402217448 | 3.22E-08 | 1.16E-09 | mr1781_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402217448 | NA | 1.15E-06 | mr1790_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402217448 | NA | 1.19E-06 | mr1827_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402217448 | 2.23E-06 | NA | mr1860_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |