\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402208784:

Variant ID: vg0402208784 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 2208784
Reference Allele: GAlternative Allele: A,C
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTTTGCGCAAAGCAAGTTTTGTAATTCTTTTCACGAGCCCTAAGACCTAGCACGGACTGATCAAATTTTAGTACCAGTGTTCATATTTAAACAATGACG[G/A,C]
TTCTGTCCACCATCCATTATGATCCCAAGGATGGCTTCCCGCCATTGAGTCGTCATGGTTTACTGAGGACGTCCACCTTCCCGCCTCTCGGGAAGTGGCT

Reverse complement sequence

AGCCACTTCCCGAGAGGCGGGAAGGTGGACGTCCTCAGTAAACCATGACGACTCAATGGCGGGAAGCCATCCTTGGGATCATAATGGATGGTGGACAGAA[C/T,G]
CGTCATTGTTTAAATATGAACACTGGTACTAAAATTTGATCAGTCCGTGCTAGGTCTTAGGGCTCGTGAAAAGAATTACAAAACTTGCTTTGCGCAAAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 29.40% 16.60% 9.35% 44.65% C: 0.02%
All Indica  2759 19.30% 18.50% 8.30% 53.86% C: 0.04%
All Japonica  1512 47.70% 16.20% 2.91% 33.20% NA
Aus  269 30.90% 0.00% 53.90% 15.24% NA
Indica I  595 8.60% 2.40% 7.56% 81.51% NA
Indica II  465 39.80% 2.80% 7.31% 50.11% NA
Indica III  913 10.30% 38.10% 8.21% 43.37% NA
Indica Intermediate  786 25.80% 17.20% 9.54% 47.33% C: 0.13%
Temperate Japonica  767 73.00% 19.00% 2.61% 5.35% NA
Tropical Japonica  504 12.70% 14.90% 2.98% 69.44% NA
Japonica Intermediate  241 40.20% 10.00% 3.73% 46.06% NA
VI/Aromatic  96 21.90% 9.40% 18.75% 50.00% NA
Intermediate  90 33.30% 23.30% 6.67% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0402208784 G -> C LOC_Os04g04610.1 upstream_gene_variant ; 2594.0bp to feature; MODIFIER silent_mutation Average:7.17; most accessible tissue: Callus, score: 30.249 N N N N
vg0402208784 G -> C LOC_Os04g04610-LOC_Os04g04620 intergenic_region ; MODIFIER silent_mutation Average:7.17; most accessible tissue: Callus, score: 30.249 N N N N
vg0402208784 G -> DEL N N silent_mutation Average:7.17; most accessible tissue: Callus, score: 30.249 N N N N
vg0402208784 G -> A LOC_Os04g04610.1 upstream_gene_variant ; 2594.0bp to feature; MODIFIER silent_mutation Average:7.17; most accessible tissue: Callus, score: 30.249 N N N N
vg0402208784 G -> A LOC_Os04g04610-LOC_Os04g04620 intergenic_region ; MODIFIER silent_mutation Average:7.17; most accessible tissue: Callus, score: 30.249 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0402208784 NA 1.90E-06 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402208784 NA 6.71E-08 mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402208784 2.16E-06 7.76E-11 mr1213 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251