\
| Variant ID: vg0402208784 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 2208784 |
| Reference Allele: G | Alternative Allele: A,C |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CTTTTGCGCAAAGCAAGTTTTGTAATTCTTTTCACGAGCCCTAAGACCTAGCACGGACTGATCAAATTTTAGTACCAGTGTTCATATTTAAACAATGACG[G/A,C]
TTCTGTCCACCATCCATTATGATCCCAAGGATGGCTTCCCGCCATTGAGTCGTCATGGTTTACTGAGGACGTCCACCTTCCCGCCTCTCGGGAAGTGGCT
AGCCACTTCCCGAGAGGCGGGAAGGTGGACGTCCTCAGTAAACCATGACGACTCAATGGCGGGAAGCCATCCTTGGGATCATAATGGATGGTGGACAGAA[C/T,G]
CGTCATTGTTTAAATATGAACACTGGTACTAAAATTTGATCAGTCCGTGCTAGGTCTTAGGGCTCGTGAAAAGAATTACAAAACTTGCTTTGCGCAAAAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 29.40% | 16.60% | 9.35% | 44.65% | C: 0.02% |
| All Indica | 2759 | 19.30% | 18.50% | 8.30% | 53.86% | C: 0.04% |
| All Japonica | 1512 | 47.70% | 16.20% | 2.91% | 33.20% | NA |
| Aus | 269 | 30.90% | 0.00% | 53.90% | 15.24% | NA |
| Indica I | 595 | 8.60% | 2.40% | 7.56% | 81.51% | NA |
| Indica II | 465 | 39.80% | 2.80% | 7.31% | 50.11% | NA |
| Indica III | 913 | 10.30% | 38.10% | 8.21% | 43.37% | NA |
| Indica Intermediate | 786 | 25.80% | 17.20% | 9.54% | 47.33% | C: 0.13% |
| Temperate Japonica | 767 | 73.00% | 19.00% | 2.61% | 5.35% | NA |
| Tropical Japonica | 504 | 12.70% | 14.90% | 2.98% | 69.44% | NA |
| Japonica Intermediate | 241 | 40.20% | 10.00% | 3.73% | 46.06% | NA |
| VI/Aromatic | 96 | 21.90% | 9.40% | 18.75% | 50.00% | NA |
| Intermediate | 90 | 33.30% | 23.30% | 6.67% | 36.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0402208784 | G -> C | LOC_Os04g04610.1 | upstream_gene_variant ; 2594.0bp to feature; MODIFIER | silent_mutation | Average:7.17; most accessible tissue: Callus, score: 30.249 | N | N | N | N |
| vg0402208784 | G -> C | LOC_Os04g04610-LOC_Os04g04620 | intergenic_region ; MODIFIER | silent_mutation | Average:7.17; most accessible tissue: Callus, score: 30.249 | N | N | N | N |
| vg0402208784 | G -> DEL | N | N | silent_mutation | Average:7.17; most accessible tissue: Callus, score: 30.249 | N | N | N | N |
| vg0402208784 | G -> A | LOC_Os04g04610.1 | upstream_gene_variant ; 2594.0bp to feature; MODIFIER | silent_mutation | Average:7.17; most accessible tissue: Callus, score: 30.249 | N | N | N | N |
| vg0402208784 | G -> A | LOC_Os04g04610-LOC_Os04g04620 | intergenic_region ; MODIFIER | silent_mutation | Average:7.17; most accessible tissue: Callus, score: 30.249 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0402208784 | NA | 1.90E-06 | mr1111 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402208784 | NA | 6.71E-08 | mr1112 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402208784 | 2.16E-06 | 7.76E-11 | mr1213 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |