Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402208784:

Variant ID: vg0402208784 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 2208784
Reference Allele: G	Alternative Allele: A,C
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTTTTGCGCAAAGCAAGTTTTGTAATTCTTTTCACGAGCCCTAAGACCTAGCACGGACTGATCAAATTTTAGTACCAGTGTTCATATTTAAACAATGACG[G/A,C]
TTCTGTCCACCATCCATTATGATCCCAAGGATGGCTTCCCGCCATTGAGTCGTCATGGTTTACTGAGGACGTCCACCTTCCCGCCTCTCGGGAAGTGGCT

Reverse complement sequence

AGCCACTTCCCGAGAGGCGGGAAGGTGGACGTCCTCAGTAAACCATGACGACTCAATGGCGGGAAGCCATCCTTGGGATCATAATGGATGGTGGACAGAA[C/T,G]
CGTCATTGTTTAAATATGAACACTGGTACTAAAATTTGATCAGTCCGTGCTAGGTCTTAGGGCTCGTGAAAAGAATTACAAAACTTGCTTTGCGCAAAAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	29.40%	16.60%	9.35%	44.65%	C: 0.02%
All Indica	2759	19.30%	18.50%	8.30%	53.86%	C: 0.04%
All Japonica	1512	47.70%	16.20%	2.91%	33.20%	NA
Aus	269	30.90%	0.00%	53.90%	15.24%	NA
Indica I	595	8.60%	2.40%	7.56%	81.51%	NA
Indica II	465	39.80%	2.80%	7.31%	50.11%	NA
Indica III	913	10.30%	38.10%	8.21%	43.37%	NA
Indica Intermediate	786	25.80%	17.20%	9.54%	47.33%	C: 0.13%
Temperate Japonica	767	73.00%	19.00%	2.61%	5.35%	NA
Tropical Japonica	504	12.70%	14.90%	2.98%	69.44%	NA
Japonica Intermediate	241	40.20%	10.00%	3.73%	46.06%	NA
VI/Aromatic	96	21.90%	9.40%	18.75%	50.00%	NA
Intermediate	90	33.30%	23.30%	6.67%	36.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0402208784	G -> C	LOC_Os04g04610.1	upstream_gene_variant ; 2594.0bp to feature; MODIFIER	silent_mutation	Average:7.17; most accessible tissue: Callus, score: 30.249	N	N	N	N
vg0402208784	G -> C	LOC_Os04g04610-LOC_Os04g04620	intergenic_region ; MODIFIER	silent_mutation	Average:7.17; most accessible tissue: Callus, score: 30.249	N	N	N	N
vg0402208784	G -> DEL	N	N	silent_mutation	Average:7.17; most accessible tissue: Callus, score: 30.249	N	N	N	N
vg0402208784	G -> A	LOC_Os04g04610.1	upstream_gene_variant ; 2594.0bp to feature; MODIFIER	silent_mutation	Average:7.17; most accessible tissue: Callus, score: 30.249	N	N	N	N
vg0402208784	G -> A	LOC_Os04g04610-LOC_Os04g04620	intergenic_region ; MODIFIER	silent_mutation	Average:7.17; most accessible tissue: Callus, score: 30.249	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0402208784	NA	1.90E-06	mr1111	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402208784	NA	6.71E-08	mr1112	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402208784	2.16E-06	7.76E-11	mr1213	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251