Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402180792:

Variant ID: vg0402180792 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 2180792
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGGTAACTGCCACGGTCACTTCCCTGTGGTTGGCGAGGATGGTAACGATACTCAGTGTCGGCCAACTGATCACTATAGCGATCACGAAGCTCTCCTATGG[T/C]
GATCCTTGCCACCTCCTGACATACATGGATGTAGTTTCTTCCTCCAGCTTCGAACATCACTGAGGGGATATCTTCACTATTACTGTTCAAGGTGACTTTG

Reverse complement sequence

CAAAGTCACCTTGAACAGTAATAGTGAAGATATCCCCTCAGTGATGTTCGAAGCTGGAGGAAGAAACTACATCCATGTATGTCAGGAGGTGGCAAGGATC[A/G]
CCATAGGAGAGCTTCGTGATCGCTATAGTGATCAGTTGGCCGACACTGAGTATCGTTACCATCCTCGCCAACCACAGGGAAGTGACCGTGGCAGTTACCT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.90%	0.20%	34.72%	33.16%	NA
All Indica	2759	20.00%	0.10%	49.58%	30.26%	NA
All Japonica	1512	55.30%	0.20%	5.16%	39.35%	NA
Aus	269	17.50%	0.40%	55.39%	26.77%	NA
Indica I	595	45.20%	0.20%	21.34%	33.28%	NA
Indica II	465	19.40%	0.20%	46.88%	33.55%	NA
Indica III	913	4.10%	0.10%	71.08%	24.75%	NA
Indica Intermediate	786	19.80%	0.10%	47.58%	32.44%	NA
Temperate Japonica	767	77.20%	0.00%	0.65%	22.16%	NA
Tropical Japonica	504	31.00%	0.40%	11.11%	57.54%	NA
Japonica Intermediate	241	36.50%	0.40%	7.05%	56.02%	NA
VI/Aromatic	96	38.50%	1.00%	12.50%	47.92%	NA
Intermediate	90	41.10%	0.00%	37.78%	21.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0402180792	T -> C	LOC_Os04g04560.1	missense_variant ; p.Thr82Ala; MODERATE	nonsynonymous_codon ; T82A	Average:14.542; most accessible tissue: Minghui63 root, score: 21.615	benign	-0.586	TOLERATED	1.00
vg0402180792	T -> DEL	LOC_Os04g04560.1	N	frameshift_variant	Average:14.542; most accessible tissue: Minghui63 root, score: 21.615	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0402180792	NA	5.02E-07	mr1002	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402180792	NA	4.60E-06	mr1002	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402180792	NA	6.57E-06	mr1077	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402180792	1.02E-06	4.01E-16	mr1182	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402180792	NA	1.34E-09	mr1182	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402180792	6.48E-06	1.38E-13	mr1282	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402180792	NA	6.22E-08	mr1282	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402180792	NA	2.81E-07	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402180792	NA	6.11E-07	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402180792	4.43E-08	1.77E-17	mr1650	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402180792	2.72E-06	2.11E-09	mr1650	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402180792	4.14E-06	9.49E-13	mr1658	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402180792	NA	8.84E-08	mr1658	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402180792	9.09E-06	9.06E-06	mr1703	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402180792	NA	6.73E-13	mr1844	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402180792	NA	1.52E-06	mr1844	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402180792	NA	1.59E-06	mr1880	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402180792	NA	4.09E-09	mr1959	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402180792	NA	3.78E-06	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402180792	NA	3.77E-13	mr1182_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402180792	NA	1.92E-06	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402180792	NA	1.06E-06	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402180792	NA	3.41E-10	mr1282_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402180792	NA	4.56E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402180792	NA	1.36E-07	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402180792	NA	4.36E-07	mr1880_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251