Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402163681:

Variant ID: vg0402163681 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 2163681
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAATGATTGCAAGGTGACTATATGACATACTCAGCAAGCCACGCAGCAAATATGCAAGTGCACAAGGATACCAAAGGATGGCATAGTAGGGTTTCATTTG[A/C]
AAAAGCAGCATTTAGCAAACATTTAAGAATTTAATAAAACAGTTAAGTAATAATTAAACAATATTAATCCAACGCTATACAACATACTCTGTTGCATAGG

Reverse complement sequence

CCTATGCAACAGAGTATGTTGTATAGCGTTGGATTAATATTGTTTAATTATTACTTAACTGTTTTATTAAATTCTTAAATGTTTGCTAAATGCTGCTTTT[T/G]
CAAATGAAACCCTACTATGCCATCCTTTGGTATCCTTGTGCACTTGCATATTTGCTGCGTGGCTTGCTGAGTATGTCATATAGTCACCTTGCAATCATTC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	26.20%	1.70%	18.01%	54.10%	NA
All Indica	2759	18.80%	0.40%	23.38%	57.38%	NA
All Japonica	1512	43.40%	4.20%	2.25%	50.20%	NA
Aus	269	11.90%	1.90%	52.42%	33.83%	NA
Indica I	595	39.80%	0.20%	7.56%	52.44%	NA
Indica II	465	18.10%	0.20%	24.30%	57.42%	NA
Indica III	913	8.50%	0.10%	34.17%	57.17%	NA
Indica Intermediate	786	15.30%	1.10%	22.26%	61.32%	NA
Temperate Japonica	767	66.00%	8.20%	0.65%	25.16%	NA
Tropical Japonica	504	13.90%	0.00%	3.57%	82.54%	NA
Japonica Intermediate	241	33.20%	0.00%	4.56%	62.24%	NA
VI/Aromatic	96	10.40%	0.00%	15.62%	73.96%	NA
Intermediate	90	23.30%	0.00%	17.78%	58.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0402163681	A -> C	LOC_Os04g04510.1	upstream_gene_variant ; 2495.0bp to feature; MODIFIER	silent_mutation	Average:7.073; most accessible tissue: Zhenshan97 flower, score: 11.396	N	N	N	N
vg0402163681	A -> C	LOC_Os04g04520.1	upstream_gene_variant ; 494.0bp to feature; MODIFIER	silent_mutation	Average:7.073; most accessible tissue: Zhenshan97 flower, score: 11.396	N	N	N	N
vg0402163681	A -> C	LOC_Os04g04530.1	downstream_gene_variant ; 2737.0bp to feature; MODIFIER	silent_mutation	Average:7.073; most accessible tissue: Zhenshan97 flower, score: 11.396	N	N	N	N
vg0402163681	A -> C	LOC_Os04g04520-LOC_Os04g04530	intergenic_region ; MODIFIER	silent_mutation	Average:7.073; most accessible tissue: Zhenshan97 flower, score: 11.396	N	N	N	N
vg0402163681	A -> DEL	N	N	silent_mutation	Average:7.073; most accessible tissue: Zhenshan97 flower, score: 11.396	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0402163681	NA	8.00E-08	mr1864	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402163681	NA	1.33E-06	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402163681	6.42E-06	NA	mr1093_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402163681	NA	6.84E-06	mr1129_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402163681	NA	1.19E-13	mr1248_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402163681	NA	3.52E-06	mr1250_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402163681	NA	2.85E-07	mr1482_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402163681	4.79E-06	8.65E-09	mr1555_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402163681	1.72E-06	1.72E-06	mr1574_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402163681	NA	9.37E-08	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402163681	NA	2.01E-06	mr1754_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402163681	NA	2.51E-06	mr1780_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402163681	NA	6.62E-08	mr1805_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402163681	NA	6.68E-08	mr1837_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402163681	NA	3.12E-06	mr1982_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251