\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402163681:

Variant ID: vg0402163681 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 2163681
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAATGATTGCAAGGTGACTATATGACATACTCAGCAAGCCACGCAGCAAATATGCAAGTGCACAAGGATACCAAAGGATGGCATAGTAGGGTTTCATTTG[A/C]
AAAAGCAGCATTTAGCAAACATTTAAGAATTTAATAAAACAGTTAAGTAATAATTAAACAATATTAATCCAACGCTATACAACATACTCTGTTGCATAGG

Reverse complement sequence

CCTATGCAACAGAGTATGTTGTATAGCGTTGGATTAATATTGTTTAATTATTACTTAACTGTTTTATTAAATTCTTAAATGTTTGCTAAATGCTGCTTTT[T/G]
CAAATGAAACCCTACTATGCCATCCTTTGGTATCCTTGTGCACTTGCATATTTGCTGCGTGGCTTGCTGAGTATGTCATATAGTCACCTTGCAATCATTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 26.20% 1.70% 18.01% 54.10% NA
All Indica  2759 18.80% 0.40% 23.38% 57.38% NA
All Japonica  1512 43.40% 4.20% 2.25% 50.20% NA
Aus  269 11.90% 1.90% 52.42% 33.83% NA
Indica I  595 39.80% 0.20% 7.56% 52.44% NA
Indica II  465 18.10% 0.20% 24.30% 57.42% NA
Indica III  913 8.50% 0.10% 34.17% 57.17% NA
Indica Intermediate  786 15.30% 1.10% 22.26% 61.32% NA
Temperate Japonica  767 66.00% 8.20% 0.65% 25.16% NA
Tropical Japonica  504 13.90% 0.00% 3.57% 82.54% NA
Japonica Intermediate  241 33.20% 0.00% 4.56% 62.24% NA
VI/Aromatic  96 10.40% 0.00% 15.62% 73.96% NA
Intermediate  90 23.30% 0.00% 17.78% 58.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0402163681 A -> C LOC_Os04g04510.1 upstream_gene_variant ; 2495.0bp to feature; MODIFIER silent_mutation Average:7.073; most accessible tissue: Zhenshan97 flower, score: 11.396 N N N N
vg0402163681 A -> C LOC_Os04g04520.1 upstream_gene_variant ; 494.0bp to feature; MODIFIER silent_mutation Average:7.073; most accessible tissue: Zhenshan97 flower, score: 11.396 N N N N
vg0402163681 A -> C LOC_Os04g04530.1 downstream_gene_variant ; 2737.0bp to feature; MODIFIER silent_mutation Average:7.073; most accessible tissue: Zhenshan97 flower, score: 11.396 N N N N
vg0402163681 A -> C LOC_Os04g04520-LOC_Os04g04530 intergenic_region ; MODIFIER silent_mutation Average:7.073; most accessible tissue: Zhenshan97 flower, score: 11.396 N N N N
vg0402163681 A -> DEL N N silent_mutation Average:7.073; most accessible tissue: Zhenshan97 flower, score: 11.396 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0402163681 NA 8.00E-08 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402163681 NA 1.33E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402163681 6.42E-06 NA mr1093_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402163681 NA 6.84E-06 mr1129_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402163681 NA 1.19E-13 mr1248_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402163681 NA 3.52E-06 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402163681 NA 2.85E-07 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402163681 4.79E-06 8.65E-09 mr1555_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402163681 1.72E-06 1.72E-06 mr1574_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402163681 NA 9.37E-08 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402163681 NA 2.01E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402163681 NA 2.51E-06 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402163681 NA 6.62E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402163681 NA 6.68E-08 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402163681 NA 3.12E-06 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251