Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402158888:

Variant ID: vg0402158888 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 2158888
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.03, others allele: 0.00, population size: 36. )

Flanking Sequence (100 bp) in Reference Genome:

TGGCCATCTGTTTGTGGGTGATAAGCTGTGCTAAACGCAAGGTAACTTCCTAGGGCTTCATGTACTTTCCCCCAGAAATGCGAGGTAAACTGTGTGCCTC[G/A]
ATCAGATATAATTTTCTTAGGTACACCATGAAGACATACTATCCTGGTCATGTATAACTCGGCTAGCTTAGCACAGCTATAATTTATCTTAACGGGAATG

Reverse complement sequence

CATTCCCGTTAAGATAAATTATAGCTGTGCTAAGCTAGCCGAGTTATACATGACCAGGATAGTATGTCTTCATGGTGTACCTAAGAAAATTATATCTGAT[C/T]
GAGGCACACAGTTTACCTCGCATTTCTGGGGGAAAGTACATGAAGCCCTAGGAAGTTACCTTGCGTTTAGCACAGCTTATCACCCACAAACAGATGGCCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	43.70%	7.60%	9.14%	39.53%	NA
All Indica	2759	26.80%	12.30%	10.08%	50.82%	NA
All Japonica	1512	65.20%	0.40%	8.27%	26.12%	NA
Aus	269	78.10%	0.00%	5.58%	16.36%	NA
Indica I	595	40.80%	2.00%	3.87%	53.28%	NA
Indica II	465	25.60%	38.70%	5.59%	30.11%	NA
Indica III	913	20.20%	2.20%	16.21%	61.45%	NA
Indica Intermediate	786	24.70%	16.20%	10.31%	48.85%	NA
Temperate Japonica	767	84.40%	0.40%	1.96%	13.30%	NA
Tropical Japonica	504	42.30%	0.40%	14.48%	42.86%	NA
Japonica Intermediate	241	52.30%	0.40%	15.35%	31.95%	NA
VI/Aromatic	96	84.40%	2.10%	5.21%	8.33%	NA
Intermediate	90	54.40%	14.40%	10.00%	21.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0402158888	G -> DEL	LOC_Os04g04510.1	N	frameshift_variant	Average:10.499; most accessible tissue: Minghui63 panicle, score: 16.27	N	N	N	N
vg0402158888	G -> A	LOC_Os04g04510.1	stop_gained ; p.Arg705*; HIGH	stop_gained	Average:10.499; most accessible tissue: Minghui63 panicle, score: 16.27	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0402158888	NA	4.83E-11	mr1059	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402158888	NA	6.47E-06	mr1062	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402158888	NA	1.92E-13	mr1143	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402158888	NA	1.65E-12	mr1167	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402158888	NA	1.31E-08	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402158888	NA	8.20E-12	mr1535	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402158888	NA	4.50E-06	mr1626	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402158888	NA	3.03E-12	mr1675	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402158888	NA	7.95E-10	mr1726	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402158888	NA	1.23E-08	mr1950	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402158888	NA	6.90E-13	mr1969	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402158888	NA	4.70E-14	mr1995	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402158888	NA	1.83E-12	mr1062_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402158888	NA	2.81E-10	mr1167_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402158888	NA	4.57E-07	mr1360_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402158888	NA	8.97E-07	mr1360_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402158888	NA	5.84E-07	mr1383_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402158888	NA	6.24E-09	mr1458_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402158888	NA	3.83E-10	mr1715_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402158888	NA	3.19E-06	mr1892_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402158888	NA	5.84E-06	mr1950_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251