\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402158888:

Variant ID: vg0402158888 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 2158888
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.03, others allele: 0.00, population size: 36. )

Flanking Sequence (100 bp) in Reference Genome:


TGGCCATCTGTTTGTGGGTGATAAGCTGTGCTAAACGCAAGGTAACTTCCTAGGGCTTCATGTACTTTCCCCCAGAAATGCGAGGTAAACTGTGTGCCTC[G/A]
ATCAGATATAATTTTCTTAGGTACACCATGAAGACATACTATCCTGGTCATGTATAACTCGGCTAGCTTAGCACAGCTATAATTTATCTTAACGGGAATG

Reverse complement sequence

CATTCCCGTTAAGATAAATTATAGCTGTGCTAAGCTAGCCGAGTTATACATGACCAGGATAGTATGTCTTCATGGTGTACCTAAGAAAATTATATCTGAT[C/T]
GAGGCACACAGTTTACCTCGCATTTCTGGGGGAAAGTACATGAAGCCCTAGGAAGTTACCTTGCGTTTAGCACAGCTTATCACCCACAAACAGATGGCCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.70% 7.60% 9.14% 39.53% NA
All Indica  2759 26.80% 12.30% 10.08% 50.82% NA
All Japonica  1512 65.20% 0.40% 8.27% 26.12% NA
Aus  269 78.10% 0.00% 5.58% 16.36% NA
Indica I  595 40.80% 2.00% 3.87% 53.28% NA
Indica II  465 25.60% 38.70% 5.59% 30.11% NA
Indica III  913 20.20% 2.20% 16.21% 61.45% NA
Indica Intermediate  786 24.70% 16.20% 10.31% 48.85% NA
Temperate Japonica  767 84.40% 0.40% 1.96% 13.30% NA
Tropical Japonica  504 42.30% 0.40% 14.48% 42.86% NA
Japonica Intermediate  241 52.30% 0.40% 15.35% 31.95% NA
VI/Aromatic  96 84.40% 2.10% 5.21% 8.33% NA
Intermediate  90 54.40% 14.40% 10.00% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0402158888 G -> DEL LOC_Os04g04510.1 N frameshift_variant Average:10.499; most accessible tissue: Minghui63 panicle, score: 16.27 N N N N
vg0402158888 G -> A LOC_Os04g04510.1 stop_gained ; p.Arg705*; HIGH stop_gained Average:10.499; most accessible tissue: Minghui63 panicle, score: 16.27 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0402158888 NA 4.83E-11 mr1059 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402158888 NA 6.47E-06 mr1062 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402158888 NA 1.92E-13 mr1143 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402158888 NA 1.65E-12 mr1167 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402158888 NA 1.31E-08 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402158888 NA 8.20E-12 mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402158888 NA 4.50E-06 mr1626 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402158888 NA 3.03E-12 mr1675 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402158888 NA 7.95E-10 mr1726 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402158888 NA 1.23E-08 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402158888 NA 6.90E-13 mr1969 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402158888 NA 4.70E-14 mr1995 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402158888 NA 1.83E-12 mr1062_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402158888 NA 2.81E-10 mr1167_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402158888 NA 4.57E-07 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402158888 NA 8.97E-07 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402158888 NA 5.84E-07 mr1383_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402158888 NA 6.24E-09 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402158888 NA 3.83E-10 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402158888 NA 3.19E-06 mr1892_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402158888 NA 5.84E-06 mr1950_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251