| Variant ID: vg0402158888 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 2158888 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.03, others allele: 0.00, population size: 36. )
TGGCCATCTGTTTGTGGGTGATAAGCTGTGCTAAACGCAAGGTAACTTCCTAGGGCTTCATGTACTTTCCCCCAGAAATGCGAGGTAAACTGTGTGCCTC[G/A]
ATCAGATATAATTTTCTTAGGTACACCATGAAGACATACTATCCTGGTCATGTATAACTCGGCTAGCTTAGCACAGCTATAATTTATCTTAACGGGAATG
CATTCCCGTTAAGATAAATTATAGCTGTGCTAAGCTAGCCGAGTTATACATGACCAGGATAGTATGTCTTCATGGTGTACCTAAGAAAATTATATCTGAT[C/T]
GAGGCACACAGTTTACCTCGCATTTCTGGGGGAAAGTACATGAAGCCCTAGGAAGTTACCTTGCGTTTAGCACAGCTTATCACCCACAAACAGATGGCCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.70% | 7.60% | 9.14% | 39.53% | NA |
| All Indica | 2759 | 26.80% | 12.30% | 10.08% | 50.82% | NA |
| All Japonica | 1512 | 65.20% | 0.40% | 8.27% | 26.12% | NA |
| Aus | 269 | 78.10% | 0.00% | 5.58% | 16.36% | NA |
| Indica I | 595 | 40.80% | 2.00% | 3.87% | 53.28% | NA |
| Indica II | 465 | 25.60% | 38.70% | 5.59% | 30.11% | NA |
| Indica III | 913 | 20.20% | 2.20% | 16.21% | 61.45% | NA |
| Indica Intermediate | 786 | 24.70% | 16.20% | 10.31% | 48.85% | NA |
| Temperate Japonica | 767 | 84.40% | 0.40% | 1.96% | 13.30% | NA |
| Tropical Japonica | 504 | 42.30% | 0.40% | 14.48% | 42.86% | NA |
| Japonica Intermediate | 241 | 52.30% | 0.40% | 15.35% | 31.95% | NA |
| VI/Aromatic | 96 | 84.40% | 2.10% | 5.21% | 8.33% | NA |
| Intermediate | 90 | 54.40% | 14.40% | 10.00% | 21.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0402158888 | G -> DEL | LOC_Os04g04510.1 | N | frameshift_variant | Average:10.499; most accessible tissue: Minghui63 panicle, score: 16.27 | N | N | N | N |
| vg0402158888 | G -> A | LOC_Os04g04510.1 | stop_gained ; p.Arg705*; HIGH | stop_gained | Average:10.499; most accessible tissue: Minghui63 panicle, score: 16.27 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0402158888 | NA | 4.83E-11 | mr1059 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402158888 | NA | 6.47E-06 | mr1062 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402158888 | NA | 1.92E-13 | mr1143 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402158888 | NA | 1.65E-12 | mr1167 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402158888 | NA | 1.31E-08 | mr1458 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402158888 | NA | 8.20E-12 | mr1535 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402158888 | NA | 4.50E-06 | mr1626 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402158888 | NA | 3.03E-12 | mr1675 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402158888 | NA | 7.95E-10 | mr1726 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402158888 | NA | 1.23E-08 | mr1950 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/