\
| Variant ID: vg0402105567 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 2105567 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TCCCAACGCCACCTTCACGTGATGAGAGGTTATCTATTAGTAATCAACCTAAGTAGCAACTTGCGGAATGTACGAGTCAAAAATCATATATTACATCGAG[T/C]
ATACCTTGATTGATAAGTTCTTGAAGGGAATATGCAGCTCACATGGTGTCCGTTGCGTGATCTCATCAACGGGGCAGGTGGTTTCGTCCTGGGTTTGCAT
ATGCAAACCCAGGACGAAACCACCTGCCCCGTTGATGAGATCACGCAACGGACACCATGTGAGCTGCATATTCCCTTCAAGAACTTATCAATCAAGGTAT[A/G]
CTCGATGTAATATATGATTTTTGACTCGTACATTCCGCAAGTTGCTACTTAGGTTGATTACTAATAGATAACCTCTCATCACGTGAAGGTGGCGTTGGGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 30.00% | 2.10% | 31.49% | 36.37% | NA |
| All Indica | 2759 | 19.70% | 3.40% | 44.87% | 32.00% | NA |
| All Japonica | 1512 | 54.20% | 0.10% | 2.18% | 43.52% | NA |
| Aus | 269 | 4.80% | 0.70% | 61.34% | 33.09% | NA |
| Indica I | 595 | 16.60% | 3.00% | 46.55% | 33.78% | NA |
| Indica II | 465 | 11.60% | 2.40% | 26.24% | 59.78% | NA |
| Indica III | 913 | 24.60% | 4.70% | 54.87% | 15.77% | NA |
| Indica Intermediate | 786 | 21.00% | 2.90% | 43.00% | 33.08% | NA |
| Temperate Japonica | 767 | 87.20% | 0.00% | 0.39% | 12.39% | NA |
| Tropical Japonica | 504 | 18.50% | 0.20% | 3.97% | 77.38% | NA |
| Japonica Intermediate | 241 | 24.10% | 0.00% | 4.15% | 71.78% | NA |
| VI/Aromatic | 96 | 12.50% | 1.00% | 35.42% | 51.04% | NA |
| Intermediate | 90 | 35.60% | 0.00% | 20.00% | 44.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0402105567 | T -> C | LOC_Os04g04410.1 | upstream_gene_variant ; 4309.0bp to feature; MODIFIER | silent_mutation | Average:6.983; most accessible tissue: Callus, score: 17.867 | N | N | N | N |
| vg0402105567 | T -> C | LOC_Os04g04430.1 | downstream_gene_variant ; 4162.0bp to feature; MODIFIER | silent_mutation | Average:6.983; most accessible tissue: Callus, score: 17.867 | N | N | N | N |
| vg0402105567 | T -> C | LOC_Os04g04420.1 | intron_variant ; MODIFIER | silent_mutation | Average:6.983; most accessible tissue: Callus, score: 17.867 | N | N | N | N |
| vg0402105567 | T -> DEL | N | N | silent_mutation | Average:6.983; most accessible tissue: Callus, score: 17.867 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0402105567 | NA | 2.24E-12 | mr1034 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402105567 | 2.61E-06 | 2.61E-06 | mr1666 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402105567 | NA | 7.05E-07 | mr1785 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402105567 | NA | 1.72E-06 | mr1211_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402105567 | NA | 3.97E-07 | mr1671_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |