\
| Variant ID: vg0402103921 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 2103921 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CCGAGATCAACATAATAGCAACAGAGTCCCGCGACTTTGGAATAGATGGCATTATATTACCTGTCTATCAGTTGGAAGACCTTGTCAAAAACCTTCTCCT[T/C]
TTTATTCATTGAGTCGTACACAGTGACTCTGCATGCGTCCAAGTCGAAAAAGAACAGGACCAGTGGAATCTAGAATATGCGTGAGATGAGATAAATATCA
TGATATTTATCTCATCTCACGCATATTCTAGATTCCACTGGTCCTGTTCTTTTTCGACTTGGACGCATGCAGAGTCACTGTGTACGACTCAATGAATAAA[A/G]
AGGAGAAGGTTTTTGACAAGGTCTTCCAACTGATAGACAGGTAATATAATGCCATCTATTCCAAAGTCGCGGGACTCTGTTGCTATTATGTTGATCTCGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.30% | 0.30% | 2.26% | 47.06% | NA |
| All Indica | 2759 | 43.00% | 0.60% | 2.43% | 54.01% | NA |
| All Japonica | 1512 | 56.50% | 0.00% | 0.86% | 42.59% | NA |
| Aus | 269 | 87.40% | 0.00% | 6.32% | 6.32% | NA |
| Indica I | 595 | 42.70% | 0.00% | 3.19% | 54.12% | NA |
| Indica II | 465 | 20.20% | 0.20% | 1.51% | 78.06% | NA |
| Indica III | 913 | 52.90% | 1.40% | 2.63% | 43.04% | NA |
| Indica Intermediate | 786 | 45.20% | 0.30% | 2.16% | 52.42% | NA |
| Temperate Japonica | 767 | 87.00% | 0.00% | 0.26% | 12.78% | NA |
| Tropical Japonica | 504 | 24.20% | 0.00% | 1.59% | 74.21% | NA |
| Japonica Intermediate | 241 | 27.40% | 0.00% | 1.24% | 71.37% | NA |
| VI/Aromatic | 96 | 57.30% | 0.00% | 8.33% | 34.38% | NA |
| Intermediate | 90 | 53.30% | 0.00% | 2.22% | 44.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0402103921 | T -> C | LOC_Os04g04420.1 | missense_variant ; p.Lys567Glu; MODERATE | nonsynonymous_codon ; K567E | Average:7.907; most accessible tissue: Zhenshan97 panicle, score: 20.424 | benign |
-0.008 |
TOLERATED | 0.52 |
| vg0402103921 | T -> DEL | LOC_Os04g04420.1 | N | frameshift_variant | Average:7.907; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0402103921 | NA | 6.17E-06 | mr1006 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402103921 | NA | 1.31E-07 | mr1030 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402103921 | NA | 8.54E-08 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402103921 | NA | 2.19E-06 | mr1285 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402103921 | NA | 1.46E-06 | mr1311 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402103921 | 3.79E-06 | 9.61E-07 | mr1339 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402103921 | NA | 7.04E-06 | mr1432 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402103921 | NA | 2.82E-06 | mr1576 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402103921 | NA | 6.82E-08 | mr1666 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402103921 | NA | 1.90E-06 | mr1727 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402103921 | NA | 8.76E-06 | mr1928 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402103921 | NA | 3.04E-06 | mr1965 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |