RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0402093212:

Variant ID: vg0402093212 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 2093212
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:

TCCCTCCAGAAATATGTCATTCATTTGGATGGATGTCATCCTCTTTCCATGAGGAATCCTAGGAAGAGATGTGCTTGGTGCTCACTCCGTGATATTCGCG[T/C]
GGCTTGCGACGTGAATTTCAGAAGCAACGAAACAACCCGGGGCAACAGTAATAGTTGCGAACATGTGTCCAAGGAAAATATGTAGCCAATAGTGTGATGA

Reverse complement sequence

TCATCACACTATTGGCTACATATTTTCCTTGGACACATGTTCGCAACTATTACTGTTGCCCCGGGTTGTTTCGTTGCTTCTGAAATTCACGTCGCAAGCC[A/G]
CGCGAATATCACGGAGTGAGCACCAAGCACATCTCTTCCTAGGATTCCTCATGGAAAGAGGATGACATCCATCCAAATGAATGACATATTTCTGGAGGGA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	14.80%	13.90%	0.32%	70.95%	NA
All Indica	2759	2.00%	5.40%	0.29%	92.35%	NA
All Japonica	1512	34.30%	32.90%	0.26%	32.61%	NA
Aus	269	15.20%	1.10%	0.00%	83.64%	NA
Indica I	595	0.20%	11.80%	0.34%	87.73%	NA
Indica II	465	0.90%	7.10%	0.22%	91.83%	NA
Indica III	913	2.50%	0.50%	0.22%	96.71%	NA
Indica Intermediate	786	3.30%	5.20%	0.38%	91.09%	NA
Temperate Japonica	767	35.20%	58.70%	0.13%	6.00%	NA
Tropical Japonica	504	28.00%	2.60%	0.60%	68.85%	NA
Japonica Intermediate	241	44.40%	14.10%	0.00%	41.49%	NA
VI/Aromatic	96	64.60%	0.00%	0.00%	35.42%	NA
Intermediate	90	26.70%	11.10%	3.33%	58.89%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0402093212	T -> C	LOC_Os04g04410.1	downstream_gene_variant ; 4932.0bp to feature; MODIFIER	silent_mutation	Average:6.056; most accessible tissue: Callus, score: 21.946	N	N	N	N
vg0402093212	T -> C	LOC_Os04g04400.1	intron_variant ; MODIFIER	silent_mutation	Average:6.056; most accessible tissue: Callus, score: 21.946	N	N	N	N
vg0402093212	T -> DEL	N	N	silent_mutation	Average:6.056; most accessible tissue: Callus, score: 21.946	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0402093212	NA	1.11E-06	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402093212	NA	2.87E-07	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402093212	9.66E-06	9.65E-06	mr1147_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402093212	NA	1.20E-08	mr1149_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402093212	NA	9.30E-07	mr1206_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402093212	NA	5.16E-09	mr1229_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402093212	NA	1.44E-08	mr1441_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402093212	NA	1.87E-09	mr1521_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402093212	NA	3.66E-06	mr1596_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402093212	NA	7.57E-06	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 13 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg0402093212:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact