\
| Variant ID: vg0402081771 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 2081771 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, A: 0.10, others allele: 0.00, population size: 209. )
GCAGGCACCCTGAACGATTTGTACCATGCTATGATATGCAGAGACAAGCGAGGAAGAACAGCAAGCAAACATCCAACACCAATTAACTGGCCATCCATTA[C/A]
CAGGGAGAAAATGTATAAGGAGGAAGAAATCACACCAGGCATACAGATTTGGCACTGAGATAGAAAGAGCATCGATTCAATACCAAATCAGGGGGGCAAA
TTTGCCCCCCTGATTTGGTATTGAATCGATGCTCTTTCTATCTCAGTGCCAAATCTGTATGCCTGGTGTGATTTCTTCCTCCTTATACATTTTCTCCCTG[G/T]
TAATGGATGGCCAGTTAATTGGTGTTGGATGTTTGCTTGCTGTTCTTCCTCGCTTGTCTCTGCATATCATAGCATGGTACAAATCGTTCAGGGTGCCTGC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.60% | 35.40% | 0.42% | 11.57% | NA |
| All Indica | 2759 | 79.60% | 19.10% | 0.18% | 1.16% | NA |
| All Japonica | 1512 | 14.80% | 56.60% | 0.60% | 27.98% | NA |
| Aus | 269 | 4.50% | 83.60% | 0.74% | 11.15% | NA |
| Indica I | 595 | 84.40% | 15.50% | 0.17% | 0.00% | NA |
| Indica II | 465 | 94.20% | 5.40% | 0.00% | 0.43% | NA |
| Indica III | 913 | 69.80% | 28.00% | 0.11% | 2.08% | NA |
| Indica Intermediate | 786 | 78.80% | 19.50% | 0.38% | 1.40% | NA |
| Temperate Japonica | 767 | 1.40% | 73.10% | 0.78% | 24.64% | NA |
| Tropical Japonica | 504 | 38.50% | 34.70% | 0.20% | 26.59% | NA |
| Japonica Intermediate | 241 | 7.90% | 49.80% | 0.83% | 41.49% | NA |
| VI/Aromatic | 96 | 6.20% | 38.50% | 2.08% | 53.12% | NA |
| Intermediate | 90 | 55.60% | 30.00% | 2.22% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0402081771 | C -> DEL | N | N | silent_mutation | Average:57.956; most accessible tissue: Callus, score: 77.97 | N | N | N | N |
| vg0402081771 | C -> A | LOC_Os04g04390.1 | intron_variant ; MODIFIER | silent_mutation | Average:57.956; most accessible tissue: Callus, score: 77.97 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0402081771 | 1.92E-06 | 1.75E-33 | mr1037 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402081771 | NA | 2.89E-06 | mr1037 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402081771 | NA | 1.93E-37 | mr1094 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402081771 | NA | 5.37E-17 | mr1147 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402081771 | NA | 5.42E-16 | mr1199 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402081771 | NA | 4.46E-21 | mr1422 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402081771 | NA | 1.05E-11 | mr1540 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402081771 | NA | 1.07E-10 | mr1720 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402081771 | 5.47E-11 | 2.89E-64 | mr1798 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402081771 | NA | 6.48E-07 | mr1798 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402081771 | 4.45E-06 | 2.59E-08 | mr1798 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402081771 | 9.99E-06 | 9.29E-33 | mr1037_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402081771 | NA | 7.33E-49 | mr1091_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402081771 | NA | 2.34E-45 | mr1094_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402081771 | NA | 5.60E-54 | mr1108_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402081771 | NA | 9.32E-50 | mr1111_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402081771 | NA | 3.45E-53 | mr1121_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402081771 | NA | 3.04E-08 | mr1126_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402081771 | NA | 2.20E-51 | mr1144_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402081771 | NA | 8.11E-14 | mr1147_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402081771 | NA | 1.55E-27 | mr1270_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402081771 | NA | 4.48E-06 | mr1439_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402081771 | NA | 2.00E-10 | mr1649_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402081771 | NA | 3.93E-08 | mr1690_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402081771 | NA | 1.03E-15 | mr1720_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402081771 | NA | 6.36E-11 | mr1734_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402081771 | NA | 3.50E-15 | mr1744_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402081771 | 6.53E-16 | 1.81E-90 | mr1798_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402081771 | NA | 3.23E-11 | mr1798_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402081771 | 1.71E-09 | 5.53E-14 | mr1798_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402081771 | NA | 2.42E-06 | mr1834_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402081771 | 2.95E-06 | NA | mr1879_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402081771 | NA | 9.62E-06 | mr1896_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402081771 | NA | 1.44E-07 | mr1991_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |