\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402062633:

Variant ID: vg0402062633 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 2062633
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.03, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


GCATCACACGAAGTTACACCAATGTCTCCGTGCTCTCCAGGGGCGGAGGCGGGCGCCGGGGAAGGGACTATATAGATATCGTTGTAGAAAGTTTCATTTT[T/C]
GTGGAAATGTATTTAAATTGGCTCAAATTTCATCAAAAAATTTGATCCAAATTTTGGAAAAAAAATCTACAATTTCTAATTTTACCGCTCCCCCCTCCCC

Reverse complement sequence

GGGGAGGGGGGAGCGGTAAAATTAGAAATTGTAGATTTTTTTTCCAAAATTTGGATCAAATTTTTTGATGAAATTTGAGCCAATTTAAATACATTTCCAC[A/G]
AAAATGAAACTTTCTACAACGATATCTATATAGTCCCTTCCCCGGCGCCCGCCTCCGCCCCTGGAGAGCACGGAGACATTGGTGTAACTTCGTGTGATGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.00% 42.30% 0.76% 0.00% NA
All Indica  2759 75.40% 24.20% 0.43% 0.00% NA
All Japonica  1512 20.60% 79.40% 0.07% 0.00% NA
Aus  269 79.90% 11.90% 8.18% 0.00% NA
Indica I  595 65.20% 34.50% 0.34% 0.00% NA
Indica II  465 93.30% 6.70% 0.00% 0.00% NA
Indica III  913 71.20% 28.40% 0.44% 0.00% NA
Indica Intermediate  786 77.20% 22.00% 0.76% 0.00% NA
Temperate Japonica  767 12.00% 88.00% 0.00% 0.00% NA
Tropical Japonica  504 34.30% 65.70% 0.00% 0.00% NA
Japonica Intermediate  241 19.10% 80.50% 0.41% 0.00% NA
VI/Aromatic  96 34.40% 65.60% 0.00% 0.00% NA
Intermediate  90 61.10% 37.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0402062633 T -> C LOC_Os04g04370.1 upstream_gene_variant ; 4749.0bp to feature; MODIFIER silent_mutation Average:44.752; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0402062633 T -> C LOC_Os04g04380.1 downstream_gene_variant ; 3549.0bp to feature; MODIFIER silent_mutation Average:44.752; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0402062633 T -> C LOC_Os04g04370-LOC_Os04g04380 intergenic_region ; MODIFIER silent_mutation Average:44.752; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0402062633 2.88E-06 1.45E-08 mr1882 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402062633 NA 5.92E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402062633 3.12E-09 NA mr1798_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402062633 6.07E-06 1.08E-10 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402062633 NA 8.78E-06 mr1896_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251