\
| Variant ID: vg0402051720 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 2051720 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GAAACAAATAGACATTTTATGAAATGTCTATATGCCTTGCGGTATTTTCGTAGAGATATTTCCTTATGCATGCCTATAAGAAAGTAGATGCACTTTCTAC[A/G]
GGCACTAAATTGTGTGGCACTTTTTATGAAAATGTTGTATGAATTTCATCAAAGCTGATTTCATATGTCCTTTTTTCTACAAATTAATGAATCTTTTTTC
GAAAAAAGATTCATTAATTTGTAGAAAAAAGGACATATGAAATCAGCTTTGATGAAATTCATACAACATTTTCATAAAAAGTGCCACACAATTTAGTGCC[T/C]
GTAGAAAGTGCATCTACTTTCTTATAGGCATGCATAAGGAAATATCTCTACGAAAATACCGCAAGGCATATAGACATTTCATAAAATGTCTATTTGTTTC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.50% | 7.50% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 96.90% | 3.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 13.40% | 86.20% | 0.37% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 93.80% | 6.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 96.40% | 3.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 96.40% | 3.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0402051720 | A -> G | LOC_Os04g04360.1 | upstream_gene_variant ; 2915.0bp to feature; MODIFIER | silent_mutation | Average:29.224; most accessible tissue: Callus, score: 71.522 | N | N | N | N |
| vg0402051720 | A -> G | LOC_Os04g04340-LOC_Os04g04360 | intergenic_region ; MODIFIER | silent_mutation | Average:29.224; most accessible tissue: Callus, score: 71.522 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0402051720 | NA | 1.74E-06 | mr1126 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402051720 | NA | 7.44E-14 | mr1231 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402051720 | NA | 4.90E-50 | mr1549 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402051720 | NA | 1.68E-53 | mr1550 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402051720 | NA | 9.28E-06 | mr1621 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402051720 | 7.36E-06 | NA | mr1705 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402051720 | NA | 2.09E-07 | mr1735 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402051720 | NA | 8.03E-51 | mr1757 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402051720 | NA | 2.94E-07 | mr1931 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402051720 | 5.23E-06 | 4.95E-44 | mr1549_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402051720 | NA | 3.58E-59 | mr1550_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402051720 | NA | 3.06E-40 | mr1757_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402051720 | NA | 1.97E-06 | mr1762_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |