\
| Variant ID: vg0402048808 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 2048808 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CACTTGTATATTACCTGGAAATTCTGTGGTGAGGAGCCAAATGAGAAATTACTTCAGGGCTTGATTGTGGCCGAGTTTAGTTCCAAACTATTTCTTCAAA[C/A]
TTTTAATTTTTTCATCACATCGAAATTTTCCTACACACGTAAACTTCCAACTTTTCCGTCACATCGTTCCAATTTTAACCAAACTTTCAATTTTATCGTG
CACGATAAAATTGAAAGTTTGGTTAAAATTGGAACGATGTGACGGAAAAGTTGGAAGTTTACGTGTGTAGGAAAATTTCGATGTGATGAAAAAATTAAAA[G/T]
TTTGAAGAAATAGTTTGGAACTAAACTCGGCCACAATCAAGCCCTGAAGTAATTTCTCATTTGGCTCCTCACCACAGAATTTCCAGGTAATATACAAGTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.40% | 46.50% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 28.30% | 71.50% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 88.30% | 11.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 22.50% | 77.30% | 0.17% | 0.00% | NA |
| Indica II | 465 | 5.40% | 94.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 43.30% | 56.50% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 29.00% | 70.90% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 67.70% | 32.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 52.20% | 47.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0402048808 | C -> A | LOC_Os04g04340.1 | upstream_gene_variant ; 4825.0bp to feature; MODIFIER | silent_mutation | Average:48.034; most accessible tissue: Callus, score: 85.415 | N | N | N | N |
| vg0402048808 | C -> A | LOC_Os04g04340-LOC_Os04g04360 | intergenic_region ; MODIFIER | silent_mutation | Average:48.034; most accessible tissue: Callus, score: 85.415 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0402048808 | NA | 2.34E-27 | mr1037 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402048808 | 3.07E-12 | 2.27E-55 | mr1798 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402048808 | 6.11E-07 | 2.68E-09 | mr1798 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402048808 | NA | 3.15E-09 | mr1946 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402048808 | 7.61E-09 | 4.79E-32 | mr1037_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402048808 | 2.40E-08 | 1.17E-07 | mr1037_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402048808 | NA | 6.26E-15 | mr1720_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402048808 | 7.80E-22 | 2.70E-81 | mr1798_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402048808 | 1.44E-10 | 5.20E-13 | mr1798_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402048808 | 4.91E-11 | 1.22E-15 | mr1798_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |