\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402048808:

Variant ID: vg0402048808 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 2048808
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACTTGTATATTACCTGGAAATTCTGTGGTGAGGAGCCAAATGAGAAATTACTTCAGGGCTTGATTGTGGCCGAGTTTAGTTCCAAACTATTTCTTCAAA[C/A]
TTTTAATTTTTTCATCACATCGAAATTTTCCTACACACGTAAACTTCCAACTTTTCCGTCACATCGTTCCAATTTTAACCAAACTTTCAATTTTATCGTG

Reverse complement sequence

CACGATAAAATTGAAAGTTTGGTTAAAATTGGAACGATGTGACGGAAAAGTTGGAAGTTTACGTGTGTAGGAAAATTTCGATGTGATGAAAAAATTAAAA[G/T]
TTTGAAGAAATAGTTTGGAACTAAACTCGGCCACAATCAAGCCCTGAAGTAATTTCTCATTTGGCTCCTCACCACAGAATTTCCAGGTAATATACAAGTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.40% 46.50% 0.08% 0.00% NA
All Indica  2759 28.30% 71.50% 0.14% 0.00% NA
All Japonica  1512 88.30% 11.70% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 22.50% 77.30% 0.17% 0.00% NA
Indica II  465 5.40% 94.60% 0.00% 0.00% NA
Indica III  913 43.30% 56.50% 0.22% 0.00% NA
Indica Intermediate  786 29.00% 70.90% 0.13% 0.00% NA
Temperate Japonica  767 99.30% 0.70% 0.00% 0.00% NA
Tropical Japonica  504 67.70% 32.30% 0.00% 0.00% NA
Japonica Intermediate  241 96.30% 3.70% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 52.20% 47.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0402048808 C -> A LOC_Os04g04340.1 upstream_gene_variant ; 4825.0bp to feature; MODIFIER silent_mutation Average:48.034; most accessible tissue: Callus, score: 85.415 N N N N
vg0402048808 C -> A LOC_Os04g04340-LOC_Os04g04360 intergenic_region ; MODIFIER silent_mutation Average:48.034; most accessible tissue: Callus, score: 85.415 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0402048808 NA 2.34E-27 mr1037 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402048808 3.07E-12 2.27E-55 mr1798 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402048808 6.11E-07 2.68E-09 mr1798 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402048808 NA 3.15E-09 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402048808 7.61E-09 4.79E-32 mr1037_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402048808 2.40E-08 1.17E-07 mr1037_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402048808 NA 6.26E-15 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402048808 7.80E-22 2.70E-81 mr1798_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402048808 1.44E-10 5.20E-13 mr1798_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402048808 4.91E-11 1.22E-15 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251