\
| Variant ID: vg0402030106 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr04 | Position: 2030106 |
| Reference Allele: CCTTA | Alternative Allele: TCTTA,C |
| Primary Allele: CCTTA | Secondary Allele: TCTTA |
Inferred Ancestral Allele: Not determined.
GTACCTCGATCAACATACTCTACAATTAATGGAACATCGATCAAACATATTAGATACATTTATCCTTACAAAAAGAAATGGAACATCAAACTAGGTTATT[CCTTA/TCTTA,C]
CTTCATCTCTATTATTCTTAACAGTGATGGGCCCTATATTTTGGGGACAGTGAGGAGGAGAATTAACCCCACCACAAGTCATCCTAATCCTTTGATGCAT
ATGCATCAAAGGATTAGGATGACTTGTGGTGGGGTTAATTCTCCTCCTCACTGTCCCCAAAATATAGGGCCCATCACTGTTAAGAATAATAGAGATGAAG[TAAGG/TAAGA,G]
AATAACCTAGTTTGATGTTCCATTTCTTTTTGTAAGGATAAATGTATCTAATATGTTTGATCGATGTTCCATTAATTGTAGAGTATGTTGATCGAGGTAC
| Populations | Population Size | Frequency of CCTTA(primary allele) | Frequency of TCTTA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.30% | 28.70% | 0.08% | 0.02% | C: 7.93% |
| All Indica | 2759 | 44.80% | 41.70% | 0.14% | 0.04% | C: 13.37% |
| All Japonica | 1512 | 88.60% | 11.20% | 0.00% | 0.00% | C: 0.13% |
| Aus | 269 | 99.60% | 0.00% | 0.00% | 0.00% | C: 0.37% |
| Indica I | 595 | 25.20% | 70.40% | 0.34% | 0.00% | C: 4.03% |
| Indica II | 465 | 11.80% | 60.20% | 0.00% | 0.00% | C: 27.96% |
| Indica III | 913 | 72.30% | 13.50% | 0.11% | 0.00% | C: 14.13% |
| Indica Intermediate | 786 | 47.10% | 41.70% | 0.13% | 0.13% | C: 10.94% |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 68.30% | 31.50% | 0.00% | 0.00% | C: 0.20% |
| Japonica Intermediate | 241 | 96.30% | 3.30% | 0.00% | 0.00% | C: 0.41% |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 60.00% | 36.70% | 0.00% | 0.00% | C: 3.33% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0402030106 | CCTTA -> C | LOC_Os04g04330.1 | upstream_gene_variant ; 4343.0bp to feature; MODIFIER | silent_mutation | Average:55.252; most accessible tissue: Callus, score: 84.742 | N | N | N | N |
| vg0402030106 | CCTTA -> C | LOC_Os04g04330.2 | upstream_gene_variant ; 4366.0bp to feature; MODIFIER | silent_mutation | Average:55.252; most accessible tissue: Callus, score: 84.742 | N | N | N | N |
| vg0402030106 | CCTTA -> C | LOC_Os04g04320.1 | downstream_gene_variant ; 3663.0bp to feature; MODIFIER | silent_mutation | Average:55.252; most accessible tissue: Callus, score: 84.742 | N | N | N | N |
| vg0402030106 | CCTTA -> C | LOC_Os04g04320.2 | downstream_gene_variant ; 3663.0bp to feature; MODIFIER | silent_mutation | Average:55.252; most accessible tissue: Callus, score: 84.742 | N | N | N | N |
| vg0402030106 | CCTTA -> C | LOC_Os04g04320-LOC_Os04g04330 | intergenic_region ; MODIFIER | silent_mutation | Average:55.252; most accessible tissue: Callus, score: 84.742 | N | N | N | N |
| vg0402030106 | CCTTA -> DEL | N | N | silent_mutation | Average:55.252; most accessible tissue: Callus, score: 84.742 | N | N | N | N |
| vg0402030106 | CCTTA -> TCTTA | LOC_Os04g04330.1 | upstream_gene_variant ; 4344.0bp to feature; MODIFIER | silent_mutation | Average:55.252; most accessible tissue: Callus, score: 84.742 | N | N | N | N |
| vg0402030106 | CCTTA -> TCTTA | LOC_Os04g04330.2 | upstream_gene_variant ; 4367.0bp to feature; MODIFIER | silent_mutation | Average:55.252; most accessible tissue: Callus, score: 84.742 | N | N | N | N |
| vg0402030106 | CCTTA -> TCTTA | LOC_Os04g04320.1 | downstream_gene_variant ; 3662.0bp to feature; MODIFIER | silent_mutation | Average:55.252; most accessible tissue: Callus, score: 84.742 | N | N | N | N |
| vg0402030106 | CCTTA -> TCTTA | LOC_Os04g04320.2 | downstream_gene_variant ; 3662.0bp to feature; MODIFIER | silent_mutation | Average:55.252; most accessible tissue: Callus, score: 84.742 | N | N | N | N |
| vg0402030106 | CCTTA -> TCTTA | LOC_Os04g04320-LOC_Os04g04330 | intergenic_region ; MODIFIER | silent_mutation | Average:55.252; most accessible tissue: Callus, score: 84.742 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0402030106 | 1.49E-07 | NA | mr1798 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402030106 | 3.12E-06 | 1.61E-08 | mr1798 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402030106 | 6.68E-06 | NA | mr1037_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402030106 | 4.12E-16 | NA | mr1798_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402030106 | NA | 1.22E-09 | mr1798_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402030106 | 2.21E-14 | 4.82E-19 | mr1798_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402030106 | NA | 9.92E-15 | mr1807_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402030106 | NA | 3.97E-07 | mr1991_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |