\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402030106:

Variant ID: vg0402030106 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 2030106
Reference Allele: CCTTAAlternative Allele: TCTTA,C
Primary Allele: CCTTASecondary Allele: TCTTA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTACCTCGATCAACATACTCTACAATTAATGGAACATCGATCAAACATATTAGATACATTTATCCTTACAAAAAGAAATGGAACATCAAACTAGGTTATT[CCTTA/TCTTA,C]
CTTCATCTCTATTATTCTTAACAGTGATGGGCCCTATATTTTGGGGACAGTGAGGAGGAGAATTAACCCCACCACAAGTCATCCTAATCCTTTGATGCAT

Reverse complement sequence

ATGCATCAAAGGATTAGGATGACTTGTGGTGGGGTTAATTCTCCTCCTCACTGTCCCCAAAATATAGGGCCCATCACTGTTAAGAATAATAGAGATGAAG[TAAGG/TAAGA,G]
AATAACCTAGTTTGATGTTCCATTTCTTTTTGTAAGGATAAATGTATCTAATATGTTTGATCGATGTTCCATTAATTGTAGAGTATGTTGATCGAGGTAC

Allele Frequencies:

Populations Population SizeFrequency of CCTTA(primary allele) Frequency of TCTTA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.30% 28.70% 0.08% 0.02% C: 7.93%
All Indica  2759 44.80% 41.70% 0.14% 0.04% C: 13.37%
All Japonica  1512 88.60% 11.20% 0.00% 0.00% C: 0.13%
Aus  269 99.60% 0.00% 0.00% 0.00% C: 0.37%
Indica I  595 25.20% 70.40% 0.34% 0.00% C: 4.03%
Indica II  465 11.80% 60.20% 0.00% 0.00% C: 27.96%
Indica III  913 72.30% 13.50% 0.11% 0.00% C: 14.13%
Indica Intermediate  786 47.10% 41.70% 0.13% 0.13% C: 10.94%
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 68.30% 31.50% 0.00% 0.00% C: 0.20%
Japonica Intermediate  241 96.30% 3.30% 0.00% 0.00% C: 0.41%
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 60.00% 36.70% 0.00% 0.00% C: 3.33%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0402030106 CCTTA -> C LOC_Os04g04330.1 upstream_gene_variant ; 4343.0bp to feature; MODIFIER silent_mutation Average:55.252; most accessible tissue: Callus, score: 84.742 N N N N
vg0402030106 CCTTA -> C LOC_Os04g04330.2 upstream_gene_variant ; 4366.0bp to feature; MODIFIER silent_mutation Average:55.252; most accessible tissue: Callus, score: 84.742 N N N N
vg0402030106 CCTTA -> C LOC_Os04g04320.1 downstream_gene_variant ; 3663.0bp to feature; MODIFIER silent_mutation Average:55.252; most accessible tissue: Callus, score: 84.742 N N N N
vg0402030106 CCTTA -> C LOC_Os04g04320.2 downstream_gene_variant ; 3663.0bp to feature; MODIFIER silent_mutation Average:55.252; most accessible tissue: Callus, score: 84.742 N N N N
vg0402030106 CCTTA -> C LOC_Os04g04320-LOC_Os04g04330 intergenic_region ; MODIFIER silent_mutation Average:55.252; most accessible tissue: Callus, score: 84.742 N N N N
vg0402030106 CCTTA -> DEL N N silent_mutation Average:55.252; most accessible tissue: Callus, score: 84.742 N N N N
vg0402030106 CCTTA -> TCTTA LOC_Os04g04330.1 upstream_gene_variant ; 4344.0bp to feature; MODIFIER silent_mutation Average:55.252; most accessible tissue: Callus, score: 84.742 N N N N
vg0402030106 CCTTA -> TCTTA LOC_Os04g04330.2 upstream_gene_variant ; 4367.0bp to feature; MODIFIER silent_mutation Average:55.252; most accessible tissue: Callus, score: 84.742 N N N N
vg0402030106 CCTTA -> TCTTA LOC_Os04g04320.1 downstream_gene_variant ; 3662.0bp to feature; MODIFIER silent_mutation Average:55.252; most accessible tissue: Callus, score: 84.742 N N N N
vg0402030106 CCTTA -> TCTTA LOC_Os04g04320.2 downstream_gene_variant ; 3662.0bp to feature; MODIFIER silent_mutation Average:55.252; most accessible tissue: Callus, score: 84.742 N N N N
vg0402030106 CCTTA -> TCTTA LOC_Os04g04320-LOC_Os04g04330 intergenic_region ; MODIFIER silent_mutation Average:55.252; most accessible tissue: Callus, score: 84.742 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0402030106 1.49E-07 NA mr1798 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402030106 3.12E-06 1.61E-08 mr1798 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402030106 6.68E-06 NA mr1037_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402030106 4.12E-16 NA mr1798_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402030106 NA 1.22E-09 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402030106 2.21E-14 4.82E-19 mr1798_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402030106 NA 9.92E-15 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402030106 NA 3.97E-07 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251