Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401963741:

Variant ID: vg0401963741 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 1963741
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:

ACATTTAATGTGAATCCCCCATTGTATGCGAGTTCAACTAAGCATGGCTAAGCAATCCCTAACTCAACATCTAATCATGTTATATCCCCAAGCTAACAAA[G/T]
GAACAAGGTAACAAATAGTATGGCTGAGACAGTAGGTAATCATCTCATGGTAGCATTGTAAAATAATGCAGTATTTAAAGGAAAACAATAGGGCATTTGC

Reverse complement sequence

GCAAATGCCCTATTGTTTTCCTTTAAATACTGCATTATTTTACAATGCTACCATGAGATGATTACCTACTGTCTCAGCCATACTATTTGTTACCTTGTTC[C/A]
TTTGTTAGCTTGGGGATATAACATGATTAGATGTTGAGTTAGGGATTGCTTAGCCATGCTTAGTTGAACTCGCATACAATGGGGGATTCACATTAAATGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.00%	7.30%	0.38%	0.40%	NA
All Indica	2759	98.80%	1.20%	0.00%	0.00%	NA
All Japonica	1512	78.10%	19.40%	1.19%	1.26%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	98.60%	1.40%	0.00%	0.00%	NA
Indica Intermediate	786	97.70%	2.30%	0.00%	0.00%	NA
Temperate Japonica	767	69.20%	28.40%	1.56%	0.78%	NA
Tropical Japonica	504	85.90%	11.50%	0.79%	1.79%	NA
Japonica Intermediate	241	90.00%	7.50%	0.83%	1.66%	NA
VI/Aromatic	96	90.60%	9.40%	0.00%	0.00%	NA
Intermediate	90	91.10%	8.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0401963741	G -> DEL	N	N	silent_mutation	Average:47.77; most accessible tissue: Zhenshan97 young leaf, score: 68.315	N	N	N	N
vg0401963741	G -> T	LOC_Os04g04200.1	downstream_gene_variant ; 4829.0bp to feature; MODIFIER	silent_mutation	Average:47.77; most accessible tissue: Zhenshan97 young leaf, score: 68.315	N	N	N	N
vg0401963741	G -> T	LOC_Os04g04210.1	downstream_gene_variant ; 2052.0bp to feature; MODIFIER	silent_mutation	Average:47.77; most accessible tissue: Zhenshan97 young leaf, score: 68.315	N	N	N	N
vg0401963741	G -> T	LOC_Os04g04220.1	downstream_gene_variant ; 3672.0bp to feature; MODIFIER	silent_mutation	Average:47.77; most accessible tissue: Zhenshan97 young leaf, score: 68.315	N	N	N	N
vg0401963741	G -> T	LOC_Os04g04210-LOC_Os04g04220	intergenic_region ; MODIFIER	silent_mutation	Average:47.77; most accessible tissue: Zhenshan97 young leaf, score: 68.315	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0401963741	9.61E-07	NA	mr1751	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401963741	4.28E-06	1.46E-06	mr1751	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251