\
| Variant ID: vg0401948084 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 1948084 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GCTCCAGTGCCGCTCCTGGGTCTCCGTCGCCATTGGCCCCCGTCCCACACTCGCGGAGAGAAAGAGAGGGGAGGATATGATTTATATGAGCCCCACGTGT[C/T]
AGTGGGACCCACCCATACTTTTGGTGAATGATAAATGGGTCCCACATATTTTTTATTTCTAATACCACCTAAGTGCCACGCAAACGCCACGTGGACAAAA
TTTTGTCCACGTGGCGTTTGCGTGGCACTTAGGTGGTATTAGAAATAAAAAATATGTGGGACCCATTTATCATTCACCAAAAGTATGGGTGGGTCCCACT[G/A]
ACACGTGGGGCTCATATAAATCATATCCTCCCCTCTCTTTCTCTCCGCGAGTGTGGGACGGGGGCCAATGGCGACGGAGACCCAGGAGCGGCACTGGAGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.10% | 19.30% | 0.08% | 3.51% | NA |
| All Indica | 2759 | 91.40% | 2.80% | 0.07% | 5.76% | NA |
| All Japonica | 1512 | 49.70% | 50.10% | 0.00% | 0.13% | NA |
| Aus | 269 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.80% | 0.20% | 0.17% | 7.90% | NA |
| Indica II | 465 | 98.90% | 0.60% | 0.00% | 0.43% | NA |
| Indica III | 913 | 89.20% | 4.30% | 0.11% | 6.46% | NA |
| Indica Intermediate | 786 | 89.30% | 4.20% | 0.00% | 6.49% | NA |
| Temperate Japonica | 767 | 59.50% | 40.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 44.00% | 56.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 30.70% | 68.50% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 54.20% | 45.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 15.60% | 2.22% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0401948084 | C -> DEL | N | N | silent_mutation | Average:61.957; most accessible tissue: Minghui63 panicle, score: 78.92 | N | N | N | N |
| vg0401948084 | C -> T | LOC_Os04g04180.1 | upstream_gene_variant ; 68.0bp to feature; MODIFIER | silent_mutation | Average:61.957; most accessible tissue: Minghui63 panicle, score: 78.92 | N | N | N | N |
| vg0401948084 | C -> T | LOC_Os04g04190.1 | upstream_gene_variant ; 1267.0bp to feature; MODIFIER | silent_mutation | Average:61.957; most accessible tissue: Minghui63 panicle, score: 78.92 | N | N | N | N |
| vg0401948084 | C -> T | LOC_Os04g04180-LOC_Os04g04190 | intergenic_region ; MODIFIER | silent_mutation | Average:61.957; most accessible tissue: Minghui63 panicle, score: 78.92 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0401948084 | NA | 4.58E-06 | mr1182 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401948084 | NA | 5.35E-06 | mr1282 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401948084 | NA | 4.64E-06 | mr1650 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401948084 | NA | 8.22E-06 | mr1658 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401948084 | 2.80E-07 | NA | mr1670 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |