\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401948084:

Variant ID: vg0401948084 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 1948084
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCTCCAGTGCCGCTCCTGGGTCTCCGTCGCCATTGGCCCCCGTCCCACACTCGCGGAGAGAAAGAGAGGGGAGGATATGATTTATATGAGCCCCACGTGT[C/T]
AGTGGGACCCACCCATACTTTTGGTGAATGATAAATGGGTCCCACATATTTTTTATTTCTAATACCACCTAAGTGCCACGCAAACGCCACGTGGACAAAA

Reverse complement sequence

TTTTGTCCACGTGGCGTTTGCGTGGCACTTAGGTGGTATTAGAAATAAAAAATATGTGGGACCCATTTATCATTCACCAAAAGTATGGGTGGGTCCCACT[G/A]
ACACGTGGGGCTCATATAAATCATATCCTCCCCTCTCTTTCTCTCCGCGAGTGTGGGACGGGGGCCAATGGCGACGGAGACCCAGGAGCGGCACTGGAGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.10% 19.30% 0.08% 3.51% NA
All Indica  2759 91.40% 2.80% 0.07% 5.76% NA
All Japonica  1512 49.70% 50.10% 0.00% 0.13% NA
Aus  269 92.90% 7.10% 0.00% 0.00% NA
Indica I  595 91.80% 0.20% 0.17% 7.90% NA
Indica II  465 98.90% 0.60% 0.00% 0.43% NA
Indica III  913 89.20% 4.30% 0.11% 6.46% NA
Indica Intermediate  786 89.30% 4.20% 0.00% 6.49% NA
Temperate Japonica  767 59.50% 40.50% 0.00% 0.00% NA
Tropical Japonica  504 44.00% 56.00% 0.00% 0.00% NA
Japonica Intermediate  241 30.70% 68.50% 0.00% 0.83% NA
VI/Aromatic  96 54.20% 45.80% 0.00% 0.00% NA
Intermediate  90 76.70% 15.60% 2.22% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401948084 C -> DEL N N silent_mutation Average:61.957; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg0401948084 C -> T LOC_Os04g04180.1 upstream_gene_variant ; 68.0bp to feature; MODIFIER silent_mutation Average:61.957; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg0401948084 C -> T LOC_Os04g04190.1 upstream_gene_variant ; 1267.0bp to feature; MODIFIER silent_mutation Average:61.957; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg0401948084 C -> T LOC_Os04g04180-LOC_Os04g04190 intergenic_region ; MODIFIER silent_mutation Average:61.957; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401948084 NA 4.58E-06 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401948084 NA 5.35E-06 mr1282 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401948084 NA 4.64E-06 mr1650 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401948084 NA 8.22E-06 mr1658 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401948084 2.80E-07 NA mr1670 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251