\
| Variant ID: vg0401913477 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 1913477 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AAAATAATGAAGTCAGAACCACAATCAAGATCAATCTATGCCTCGATGATGGAGAACACGCAATTCTCCTCCCCCCAATAATGATGTAGGCTCCCATCAA[T/C]
TGCCCATTTTATCCAAAATGGCTTATTAGAAAATTAAAATTAATTTATAAGTAAAACTTCTGTAGATTTATTCGTAGCGACTTAAAAGCCAACATTAACA
TGTTAATGTTGGCTTTTAAGTCGCTACGAATAAATCTACAGAAGTTTTACTTATAAATTAATTTTAATTTTCTAATAAGCCATTTTGGATAAAATGGGCA[A/G]
TTGATGGGAGCCTACATCATTATTGGGGGGAGGAGAATTGCGTGTTCTCCATCATCGAGGCATAGATTGATCTTGATTGTGGTTCTGACTTCATTATTTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.80% | 2.00% | 0.30% | 5.84% | NA |
| All Indica | 2759 | 98.10% | 0.70% | 0.04% | 1.20% | NA |
| All Japonica | 1512 | 81.20% | 5.00% | 0.79% | 12.96% | NA |
| Aus | 269 | 93.30% | 0.40% | 0.00% | 6.32% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.20% | 0.00% | 0.22% | NA |
| Indica III | 913 | 97.40% | 0.20% | 0.11% | 2.30% | NA |
| Indica Intermediate | 786 | 96.70% | 1.90% | 0.00% | 1.40% | NA |
| Temperate Japonica | 767 | 81.00% | 9.90% | 1.56% | 7.56% | NA |
| Tropical Japonica | 504 | 90.10% | 0.00% | 0.00% | 9.92% | NA |
| Japonica Intermediate | 241 | 63.50% | 0.00% | 0.00% | 36.51% | NA |
| VI/Aromatic | 96 | 68.80% | 1.00% | 0.00% | 30.21% | NA |
| Intermediate | 90 | 97.80% | 0.00% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0401913477 | T -> C | LOC_Os04g04150.1 | upstream_gene_variant ; 4949.0bp to feature; MODIFIER | silent_mutation | Average:61.479; most accessible tissue: Callus, score: 84.176 | N | N | N | N |
| vg0401913477 | T -> C | LOC_Os04g04140.1 | downstream_gene_variant ; 2281.0bp to feature; MODIFIER | silent_mutation | Average:61.479; most accessible tissue: Callus, score: 84.176 | N | N | N | N |
| vg0401913477 | T -> C | LOC_Os04g04130-LOC_Os04g04140 | intergenic_region ; MODIFIER | silent_mutation | Average:61.479; most accessible tissue: Callus, score: 84.176 | N | N | N | N |
| vg0401913477 | T -> DEL | N | N | silent_mutation | Average:61.479; most accessible tissue: Callus, score: 84.176 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0401913477 | NA | 6.71E-07 | mr1028 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401913477 | NA | 8.61E-06 | mr1245 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401913477 | 3.67E-07 | 3.67E-07 | mr1369 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401913477 | NA | 4.10E-07 | mr1453 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401913477 | NA | 6.90E-07 | mr1648 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401913477 | NA | 3.51E-07 | mr1652 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401913477 | NA | 6.17E-06 | mr1683 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401913477 | NA | 6.73E-07 | mr1697 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |