Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401913477:

Variant ID: vg0401913477 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 1913477
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAAATAATGAAGTCAGAACCACAATCAAGATCAATCTATGCCTCGATGATGGAGAACACGCAATTCTCCTCCCCCCAATAATGATGTAGGCTCCCATCAA[T/C]
TGCCCATTTTATCCAAAATGGCTTATTAGAAAATTAAAATTAATTTATAAGTAAAACTTCTGTAGATTTATTCGTAGCGACTTAAAAGCCAACATTAACA

Reverse complement sequence

TGTTAATGTTGGCTTTTAAGTCGCTACGAATAAATCTACAGAAGTTTTACTTATAAATTAATTTTAATTTTCTAATAAGCCATTTTGGATAAAATGGGCA[A/G]
TTGATGGGAGCCTACATCATTATTGGGGGGAGGAGAATTGCGTGTTCTCCATCATCGAGGCATAGATTGATCTTGATTGTGGTTCTGACTTCATTATTTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.80%	2.00%	0.30%	5.84%	NA
All Indica	2759	98.10%	0.70%	0.04%	1.20%	NA
All Japonica	1512	81.20%	5.00%	0.79%	12.96%	NA
Aus	269	93.30%	0.40%	0.00%	6.32%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.60%	0.20%	0.00%	0.22%	NA
Indica III	913	97.40%	0.20%	0.11%	2.30%	NA
Indica Intermediate	786	96.70%	1.90%	0.00%	1.40%	NA
Temperate Japonica	767	81.00%	9.90%	1.56%	7.56%	NA
Tropical Japonica	504	90.10%	0.00%	0.00%	9.92%	NA
Japonica Intermediate	241	63.50%	0.00%	0.00%	36.51%	NA
VI/Aromatic	96	68.80%	1.00%	0.00%	30.21%	NA
Intermediate	90	97.80%	0.00%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0401913477	T -> C	LOC_Os04g04150.1	upstream_gene_variant ; 4949.0bp to feature; MODIFIER	silent_mutation	Average:61.479; most accessible tissue: Callus, score: 84.176	N	N	N	N
vg0401913477	T -> C	LOC_Os04g04140.1	downstream_gene_variant ; 2281.0bp to feature; MODIFIER	silent_mutation	Average:61.479; most accessible tissue: Callus, score: 84.176	N	N	N	N
vg0401913477	T -> C	LOC_Os04g04130-LOC_Os04g04140	intergenic_region ; MODIFIER	silent_mutation	Average:61.479; most accessible tissue: Callus, score: 84.176	N	N	N	N
vg0401913477	T -> DEL	N	N	silent_mutation	Average:61.479; most accessible tissue: Callus, score: 84.176	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0401913477	NA	6.71E-07	mr1028	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401913477	NA	8.61E-06	mr1245	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401913477	3.67E-07	3.67E-07	mr1369	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401913477	NA	4.10E-07	mr1453	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401913477	NA	6.90E-07	mr1648	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401913477	NA	3.51E-07	mr1652	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401913477	NA	6.17E-06	mr1683	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401913477	NA	6.73E-07	mr1697	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251