\
| Variant ID: vg0401901910 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 1901910 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GGTCTCCACTCTGGCCGCCTTTGTGTCGTAGCAGCCTAGCTCCATCGCCTCCGTAGTCAGCCATCTTCGAGTTGCCGAGTGGCAACCGTGTTCCCATGTC[G/A]
GCCACATCTGCTTACACTGCCGATTGCCTGAACAATTTCGCGGTCGGCTGCCTCCACGCCACCGCGTGGTGAACATGTCCCCGGGCTAGCCGGCACCAAC
GTTGGTGCCGGCTAGCCCGGGGACATGTTCACCACGCGGTGGCGTGGAGGCAGCCGACCGCGAAATTGTTCAGGCAATCGGCAGTGTAAGCAGATGTGGC[C/T]
GACATGGGAACACGGTTGCCACTCGGCAACTCGAAGATGGCTGACTACGGAGGCGATGGAGCTAGGCTGCTACGACACAAAGGCGGCCAGAGTGGAGACC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.80% | 5.10% | 0.59% | 1.46% | NA |
| All Indica | 2759 | 99.30% | 0.20% | 0.07% | 0.36% | NA |
| All Japonica | 1512 | 79.10% | 15.30% | 1.72% | 3.90% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.10% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 98.20% | 0.40% | 0.25% | 1.15% | NA |
| Temperate Japonica | 767 | 86.80% | 3.40% | 2.09% | 7.69% | NA |
| Tropical Japonica | 504 | 67.10% | 31.00% | 1.98% | 0.00% | NA |
| Japonica Intermediate | 241 | 79.70% | 20.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0401901910 | G -> DEL | N | N | silent_mutation | Average:70.593; most accessible tissue: Zhenshan97 young leaf, score: 90.456 | N | N | N | N |
| vg0401901910 | G -> A | LOC_Os04g04130.1 | upstream_gene_variant ; 3529.0bp to feature; MODIFIER | silent_mutation | Average:70.593; most accessible tissue: Zhenshan97 young leaf, score: 90.456 | N | N | N | N |
| vg0401901910 | G -> A | LOC_Os04g04120.1 | intron_variant ; MODIFIER | silent_mutation | Average:70.593; most accessible tissue: Zhenshan97 young leaf, score: 90.456 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0401901910 | 1.67E-07 | 2.81E-18 | mr1410 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401901910 | NA | 5.62E-12 | mr1410 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401901910 | NA | 4.86E-07 | mr1668 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401901910 | 7.88E-06 | NA | mr1104_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401901910 | 8.53E-07 | 1.40E-17 | mr1410_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401901910 | NA | 6.20E-12 | mr1410_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401901910 | 8.20E-08 | NA | mr1798_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401901910 | 1.83E-06 | NA | mr1798_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |