\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401895649:

Variant ID: vg0401895649 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 1895649
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTAGTCGCGCCTTACGCTCCCAAAAACCTGATCGCCCGCCCGTCCGTGCAAACGTCGCAGCAGCGCGTGGTTTTGGAGGCCTACTCTCCCAATGCGTGTG[C/T]
ACACACTCGTCGGGATGGGATTACCGTAGCAGCAACAGCGTTGGAAAATGGATGAAAGTGTGTCTCACTTTCTCTTTTGGGAGATCAAATCCATTCTCAT

Reverse complement sequence

ATGAGAATGGATTTGATCTCCCAAAAGAGAAAGTGAGACACACTTTCATCCATTTTCCAACGCTGTTGCTGCTACGGTAATCCCATCCCGACGAGTGTGT[G/A]
CACACGCATTGGGAGAGTAGGCCTCCAAAACCACGCGCTGCTGCGACGTTTGCACGGACGGGCGGGCGATCAGGTTTTTGGGAGCGTAAGGCGCGACTAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.70% 10.40% 6.09% 6.88% NA
All Indica  2759 86.00% 1.20% 8.74% 4.02% NA
All Japonica  1512 58.00% 25.90% 2.38% 13.69% NA
Aus  269 92.20% 7.10% 0.00% 0.74% NA
Indica I  595 77.50% 0.00% 16.97% 5.55% NA
Indica II  465 85.60% 0.20% 10.32% 3.87% NA
Indica III  913 91.60% 2.40% 3.07% 2.96% NA
Indica Intermediate  786 86.30% 1.40% 8.14% 4.20% NA
Temperate Japonica  767 53.70% 34.70% 1.43% 10.17% NA
Tropical Japonica  504 68.10% 15.90% 3.37% 12.70% NA
Japonica Intermediate  241 50.60% 19.10% 3.32% 26.97% NA
VI/Aromatic  96 60.40% 37.50% 2.08% 0.00% NA
Intermediate  90 74.40% 10.00% 10.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401895649 C -> DEL N N silent_mutation Average:20.47; most accessible tissue: Zhenshan97 flag leaf, score: 28.494 N N N N
vg0401895649 C -> T LOC_Os04g04100.1 downstream_gene_variant ; 744.0bp to feature; MODIFIER silent_mutation Average:20.47; most accessible tissue: Zhenshan97 flag leaf, score: 28.494 N N N N
vg0401895649 C -> T LOC_Os04g04120.1 downstream_gene_variant ; 1041.0bp to feature; MODIFIER silent_mutation Average:20.47; most accessible tissue: Zhenshan97 flag leaf, score: 28.494 N N N N
vg0401895649 C -> T LOC_Os04g04100-LOC_Os04g04120 intergenic_region ; MODIFIER silent_mutation Average:20.47; most accessible tissue: Zhenshan97 flag leaf, score: 28.494 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401895649 NA 7.06E-23 Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0401895649 NA 1.54E-10 mr1549 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401895649 NA 3.94E-08 mr1624 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401895649 3.00E-06 NA mr1670 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401895649 NA 5.92E-09 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401895649 NA 2.55E-06 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251