\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401895360:

Variant ID: vg0401895360 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 1895360
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, C: 0.07, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


ATCCAGTGATAATGGTGAATGTAATCAACATGAGCATGCTTAATGTAGAATAAGCATCAACAATCACATAATAACACAATGTTGACATTGCGATGAACAT[C/T]
AACAGTAAAACTTCTAATTGAAATAATGTAAGAAGGTTATACCCCAAGAATGGTCCTCCGCTGGAGTTTGAGGCAGTATTACCTCCGTTGATGTTGACGG

Reverse complement sequence

CCGTCAACATCAACGGAGGTAATACTGCCTCAAACTCCAGCGGAGGACCATTCTTGGGGTATAACCTTCTTACATTATTTCAATTAGAAGTTTTACTGTT[G/A]
ATGTTCATCGCAATGTCAACATTGTGTTATTATGTGATTGTTGATGCTTATTCTACATTAAGCATGCTCATGTTGATTACATTCACCATTATCACTGGAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.40% 9.00% 0.34% 4.27% NA
All Indica  2759 99.20% 0.40% 0.07% 0.33% NA
All Japonica  1512 59.70% 26.70% 0.86% 12.70% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 97.80% 0.80% 0.25% 1.15% NA
Temperate Japonica  767 44.50% 43.40% 1.43% 10.69% NA
Tropical Japonica  504 87.70% 3.40% 0.40% 8.53% NA
Japonica Intermediate  241 49.80% 22.40% 0.00% 27.80% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 88.90% 8.90% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401895360 C -> DEL N N silent_mutation Average:17.6; most accessible tissue: Zhenshan97 flag leaf, score: 36.135 N N N N
vg0401895360 C -> T LOC_Os04g04100.1 downstream_gene_variant ; 455.0bp to feature; MODIFIER silent_mutation Average:17.6; most accessible tissue: Zhenshan97 flag leaf, score: 36.135 N N N N
vg0401895360 C -> T LOC_Os04g04120.1 downstream_gene_variant ; 1330.0bp to feature; MODIFIER silent_mutation Average:17.6; most accessible tissue: Zhenshan97 flag leaf, score: 36.135 N N N N
vg0401895360 C -> T LOC_Os04g04100-LOC_Os04g04120 intergenic_region ; MODIFIER silent_mutation Average:17.6; most accessible tissue: Zhenshan97 flag leaf, score: 36.135 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401895360 NA 2.47E-09 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401895360 NA 1.64E-07 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401895360 NA 7.76E-09 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401895360 2.95E-08 2.28E-17 mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401895360 NA 1.99E-09 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401895360 1.45E-07 2.20E-15 mr1282 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401895360 NA 9.64E-09 mr1282 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401895360 8.27E-06 8.27E-06 mr1465 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401895360 8.51E-08 3.62E-16 mr1650 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401895360 NA 3.54E-08 mr1650 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401895360 1.17E-06 2.29E-13 mr1658 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401895360 NA 1.19E-07 mr1658 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401895360 NA 2.51E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401895360 NA 7.28E-10 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401895360 NA 2.96E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401895360 NA 5.95E-07 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401895360 NA 4.52E-08 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401895360 NA 2.84E-13 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401895360 NA 2.29E-06 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401895360 NA 6.34E-07 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401895360 NA 2.06E-11 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401895360 NA 4.83E-06 mr1282_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401895360 NA 8.60E-08 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401895360 NA 6.48E-08 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251