\
| Variant ID: vg0401887481 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 1887481 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 281. )
GAACTTGGGAAACCAATATGGATACAATCCGAATAGTCCTTGTCGTTTCCGTGTAGAACTCTGGTTGCCTTTCCTTATTGGAACTCCTCCTATATCCGAA[G/T]
GTTGCTTCCGTATAGGACATGGTATGTGGTGAGCCCTGTCGAGATTTAGTCAACTACTATTAGGTATGTGGTATCCATAACCCTGACAGTAGCCCCCGAC
GTCGGGGGCTACTGTCAGGGTTATGGATACCACATACCTAATAGTAGTTGACTAAATCTCGACAGGGCTCACCACATACCATGTCCTATACGGAAGCAAC[C/A]
TTCGGATATAGGAGGAGTTCCAATAAGGAAAGGCAACCAGAGTTCTACACGGAAACGACAAGGACTATTCGGATTGTATCCATATTGGTTTCCCAAGTTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.80% | 0.30% | 0.97% | 5.01% | NA |
| All Indica | 2759 | 99.50% | 0.00% | 0.14% | 0.33% | NA |
| All Japonica | 1512 | 81.70% | 0.80% | 2.71% | 14.81% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.00% | 0.00% | 0.43% | NA |
| Indica III | 913 | 99.80% | 0.00% | 0.11% | 0.11% | NA |
| Indica Intermediate | 786 | 98.90% | 0.00% | 0.38% | 0.76% | NA |
| Temperate Japonica | 767 | 90.00% | 0.00% | 0.39% | 9.65% | NA |
| Tropical Japonica | 504 | 70.00% | 1.80% | 6.15% | 22.02% | NA |
| Japonica Intermediate | 241 | 79.70% | 1.20% | 2.90% | 16.18% | NA |
| VI/Aromatic | 96 | 95.80% | 0.00% | 1.04% | 3.12% | NA |
| Intermediate | 90 | 98.90% | 0.00% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0401887481 | G -> DEL | N | N | silent_mutation | Average:53.432; most accessible tissue: Minghui63 young leaf, score: 77.243 | N | N | N | N |
| vg0401887481 | G -> T | LOC_Os04g04080.1 | downstream_gene_variant ; 2763.0bp to feature; MODIFIER | silent_mutation | Average:53.432; most accessible tissue: Minghui63 young leaf, score: 77.243 | N | N | N | N |
| vg0401887481 | G -> T | LOC_Os04g04080-LOC_Os04g04100 | intergenic_region ; MODIFIER | silent_mutation | Average:53.432; most accessible tissue: Minghui63 young leaf, score: 77.243 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0401887481 | NA | 2.48E-06 | mr1040 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401887481 | NA | 6.07E-06 | mr1155 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401887481 | NA | 1.09E-07 | mr1194 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401887481 | NA | 1.48E-07 | mr1213 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401887481 | NA | 2.21E-06 | mr1225 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401887481 | NA | 6.05E-16 | mr1301 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401887481 | 4.26E-06 | 2.37E-16 | mr1410 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401887481 | NA | 1.40E-06 | mr1805 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401887481 | 1.78E-08 | 2.64E-20 | mr1301_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401887481 | 1.32E-07 | 7.05E-18 | mr1410_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401887481 | NA | 1.74E-08 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401887481 | 6.05E-06 | NA | mr1798_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |