\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401881382:

Variant ID: vg0401881382 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 1881382
Reference Allele: CAlternative Allele: T,A
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


GACTGGACTAGGGCATTACCCCTGAGAGCCTGAATCAGTATAAACTCTGTGTAACCATATCTCCTTAATTTCGTGCACCCTATAAATTATATTGCGGATC[C/T,A]
AGAGAATCGACTGTTGATACGCCAGGTAGAGGGGCGCTAGATCAATCATCAGGAGGAGATGGCTTCAATCACCGATTGATACCGTCGACGAGATCGCGTT

Reverse complement sequence

AACGCGATCTCGTCGACGGTATCAATCGGTGATTGAAGCCATCTCCTCCTGATGATTGATCTAGCGCCCCTCTACCTGGCGTATCAACAGTCGATTCTCT[G/A,T]
GATCCGCAATATAATTTATAGGGTGCACGAAATTAAGGAGATATGGTTACACAGAGTTTATACTGATTCAGGCTCTCAGGGGTAATGCCCTAGTCCAGTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.90% 43.10% 0.11% 0.00% A: 0.93%
All Indica  2759 82.40% 17.40% 0.11% 0.00% A: 0.07%
All Japonica  1512 14.80% 84.90% 0.13% 0.00% A: 0.13%
Aus  269 28.30% 71.00% 0.00% 0.00% A: 0.74%
Indica I  595 98.30% 1.30% 0.34% 0.00% NA
Indica II  465 94.60% 4.90% 0.00% 0.00% A: 0.43%
Indica III  913 72.40% 27.60% 0.00% 0.00% NA
Indica Intermediate  786 74.70% 25.20% 0.13% 0.00% NA
Temperate Japonica  767 0.80% 99.20% 0.00% 0.00% NA
Tropical Japonica  504 39.90% 59.70% 0.40% 0.00% NA
Japonica Intermediate  241 7.10% 92.10% 0.00% 0.00% A: 0.83%
VI/Aromatic  96 12.50% 47.90% 0.00% 0.00% A: 39.58%
Intermediate  90 63.30% 36.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401881382 C -> A LOC_Os04g04060.1 upstream_gene_variant ; 4370.0bp to feature; MODIFIER silent_mutation Average:77.984; most accessible tissue: Zhenshan97 panicle, score: 86.788 N N N N
vg0401881382 C -> A LOC_Os04g04070.1 upstream_gene_variant ; 1503.0bp to feature; MODIFIER silent_mutation Average:77.984; most accessible tissue: Zhenshan97 panicle, score: 86.788 N N N N
vg0401881382 C -> A LOC_Os04g04080.1 upstream_gene_variant ; 1565.0bp to feature; MODIFIER silent_mutation Average:77.984; most accessible tissue: Zhenshan97 panicle, score: 86.788 N N N N
vg0401881382 C -> A LOC_Os04g04070-LOC_Os04g04080 intergenic_region ; MODIFIER silent_mutation Average:77.984; most accessible tissue: Zhenshan97 panicle, score: 86.788 N N N N
vg0401881382 C -> T LOC_Os04g04060.1 upstream_gene_variant ; 4370.0bp to feature; MODIFIER silent_mutation Average:77.984; most accessible tissue: Zhenshan97 panicle, score: 86.788 N N N N
vg0401881382 C -> T LOC_Os04g04070.1 upstream_gene_variant ; 1503.0bp to feature; MODIFIER silent_mutation Average:77.984; most accessible tissue: Zhenshan97 panicle, score: 86.788 N N N N
vg0401881382 C -> T LOC_Os04g04080.1 upstream_gene_variant ; 1565.0bp to feature; MODIFIER silent_mutation Average:77.984; most accessible tissue: Zhenshan97 panicle, score: 86.788 N N N N
vg0401881382 C -> T LOC_Os04g04070-LOC_Os04g04080 intergenic_region ; MODIFIER silent_mutation Average:77.984; most accessible tissue: Zhenshan97 panicle, score: 86.788 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401881382 NA 1.35E-12 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401881382 NA 1.85E-07 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401881382 NA 5.70E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401881382 NA 1.80E-07 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401881382 NA 1.86E-09 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401881382 NA 6.46E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401881382 NA 1.03E-06 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401881382 NA 8.27E-08 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401881382 NA 1.13E-49 mr1798 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401881382 NA 2.49E-06 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401881382 NA 6.97E-06 mr1798 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401881382 NA 7.99E-06 mr1872 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401881382 NA 9.39E-06 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401881382 NA 7.42E-06 mr1040_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401881382 NA 8.15E-06 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401881382 NA 4.66E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401881382 NA 4.46E-08 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401881382 NA 4.32E-06 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401881382 NA 1.94E-07 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401881382 3.22E-06 3.28E-06 mr1642_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401881382 NA 2.17E-07 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401881382 3.23E-06 7.39E-72 mr1798_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401881382 NA 8.46E-10 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401881382 6.63E-07 7.21E-12 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401881382 NA 1.56E-15 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401881382 NA 7.83E-06 mr1844_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251