Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401817725:

Variant ID: vg0401817725 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 1817725
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:


CCCCAAAAGTAGCAACGCTAGCTAAAGACCATAGATGGCCATTCCAAAGGATGGACTCTAGAACCACTGAGACCGAAGAGAGTGCAGAGTCGAAAACCCT[G/A]
GAGTTTCGTTCCTTCTACAGTTGCCAAGAGATCAGGAGGACCAAGGAGTCGAAGCCAGCACGGAGATACTCAGGTAAACAGGCCCTAGAAGATGGCCACC

Reverse complement sequence

GGTGGCCATCTTCTAGGGCCTGTTTACCTGAGTATCTCCGTGCTGGCTTCGACTCCTTGGTCCTCCTGATCTCTTGGCAACTGTAGAAGGAACGAAACTC[C/T]
AGGGTTTTCGACTCTGCACTCTCTTCGGTCTCAGTGGTTCTAGAGTCCATCCTTTGGAATGGCCATCTATGGTCTTTAGCTAGCGTTGCTACTTTTGGGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.70% 18.30% 0.04% 0.00% NA
All Indica  2759 86.40% 13.50% 0.07% 0.00% NA
All Japonica  1512 71.60% 28.40% 0.00% 0.00% NA
Aus  269 97.40% 2.60% 0.00% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 68.00% 31.80% 0.22% 0.00% NA
Indica III  913 84.20% 15.80% 0.00% 0.00% NA
Indica Intermediate  786 90.20% 9.70% 0.13% 0.00% NA
Temperate Japonica  767 94.40% 5.60% 0.00% 0.00% NA
Tropical Japonica  504 36.10% 63.90% 0.00% 0.00% NA
Japonica Intermediate  241 73.40% 26.60% 0.00% 0.00% NA
VI/Aromatic  96 56.20% 43.80% 0.00% 0.00% NA
Intermediate  90 85.60% 14.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401817725 G -> A LOC_Os04g03980.1 upstream_gene_variant ; 1652.0bp to feature; MODIFIER silent_mutation Average:56.661; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N
vg0401817725 G -> A LOC_Os04g03980-LOC_Os04g03990 intergenic_region ; MODIFIER silent_mutation Average:56.661; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401817725 NA 2.45E-06 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401817725 NA 1.64E-07 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401817725 NA 6.97E-06 mr1224 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401817725 3.10E-06 4.35E-07 mr1225 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401817725 NA 3.82E-07 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401817725 NA 5.59E-12 mr1235 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401817725 NA 1.94E-09 mr1251 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401817725 NA 5.48E-14 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401817725 NA 5.59E-12 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401817725 NA 1.47E-10 mr1435 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401817725 NA 8.13E-07 mr1525 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401817725 NA 8.34E-08 mr1525 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401817725 NA 1.35E-10 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401817725 NA 5.99E-16 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401817725 NA 8.60E-17 mr1771 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401817725 NA 1.78E-11 mr1784 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401817725 NA 6.19E-08 mr1800 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401817725 NA 4.04E-06 mr1944 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401817725 NA 6.72E-10 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401817725 NA 1.20E-17 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401817725 NA 8.88E-06 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401817725 NA 2.80E-10 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401817725 NA 2.32E-14 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401817725 NA 6.08E-13 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401817725 NA 1.88E-13 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401817725 NA 7.52E-07 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401817725 NA 4.12E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401817725 NA 9.80E-15 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401817725 NA 9.17E-14 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251