Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401805399:

Variant ID: vg0401805399 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 1805399
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, T: 0.03, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

ATCCTTTTTAATGCGGTTATATAATTCTTTGGAATTATTACCATGCAAATTAAAAGGTACCCGACAGAAAAGTGTTATACTATTTTTGTAAGCTTTTTTA[T/G]
GCTGCAAAAGCTATCTTGGTTGATTTGGGATGACTTGTTTTTACCATGGTCATTCTCTTGGCGTGTTATATGCCTACTTTAATTGTGGTAAGAGTCATAG

Reverse complement sequence

CTATGACTCTTACCACAATTAAAGTAGGCATATAACACGCCAAGAGAATGACCATGGTAAAAACAAGTCATCCCAAATCAACCAAGATAGCTTTTGCAGC[A/C]
TAAAAAAGCTTACAAAAATAGTATAACACTTTTCTGTCGGGTACCTTTTAATTTGCATGGTAATAATTCCAAAGAATTATATAACCGCATTAAAAAGGAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	43.60%	10.30%	12.38%	33.64%	NA
All Indica	2759	30.90%	1.20%	16.82%	51.11%	NA
All Japonica	1512	67.90%	29.40%	0.66%	2.05%	NA
Aus	269	33.80%	0.40%	25.28%	40.52%	NA
Indica I	595	15.10%	1.00%	30.25%	53.61%	NA
Indica II	465	39.40%	1.30%	10.54%	48.82%	NA
Indica III	913	39.00%	0.10%	9.97%	50.93%	NA
Indica Intermediate	786	28.50%	2.40%	18.32%	50.76%	NA
Temperate Japonica	767	45.10%	54.40%	0.26%	0.26%	NA
Tropical Japonica	504	92.70%	1.40%	0.79%	5.16%	NA
Japonica Intermediate	241	88.40%	8.70%	1.66%	1.24%	NA
VI/Aromatic	96	57.30%	0.00%	34.38%	8.33%	NA
Intermediate	90	41.10%	12.20%	11.11%	35.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0401805399	T -> DEL	N	N	silent_mutation	Average:23.157; most accessible tissue: Minghui63 young leaf, score: 43.347	N	N	N	N
vg0401805399	T -> G	LOC_Os04g03950.1	upstream_gene_variant ; 478.0bp to feature; MODIFIER	silent_mutation	Average:23.157; most accessible tissue: Minghui63 young leaf, score: 43.347	N	N	N	N
vg0401805399	T -> G	LOC_Os04g03970.1	upstream_gene_variant ; 3070.0bp to feature; MODIFIER	silent_mutation	Average:23.157; most accessible tissue: Minghui63 young leaf, score: 43.347	N	N	N	N
vg0401805399	T -> G	LOC_Os04g03940.1	downstream_gene_variant ; 4700.0bp to feature; MODIFIER	silent_mutation	Average:23.157; most accessible tissue: Minghui63 young leaf, score: 43.347	N	N	N	N
vg0401805399	T -> G	LOC_Os04g03960.1	downstream_gene_variant ; 1110.0bp to feature; MODIFIER	silent_mutation	Average:23.157; most accessible tissue: Minghui63 young leaf, score: 43.347	N	N	N	N
vg0401805399	T -> G	LOC_Os04g03950-LOC_Os04g03960	intergenic_region ; MODIFIER	silent_mutation	Average:23.157; most accessible tissue: Minghui63 young leaf, score: 43.347	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0401805399	NA	2.54E-06	mr1182	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401805399	NA	2.09E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401805399	NA	6.59E-06	mr1650	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401805399	NA	1.74E-07	mr1805	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401805399	NA	3.10E-07	mr1880	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401805399	NA	2.29E-07	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401805399	NA	1.17E-06	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401805399	2.32E-06	NA	mr1933_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251