\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401805399:

Variant ID: vg0401805399 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 1805399
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, T: 0.03, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


ATCCTTTTTAATGCGGTTATATAATTCTTTGGAATTATTACCATGCAAATTAAAAGGTACCCGACAGAAAAGTGTTATACTATTTTTGTAAGCTTTTTTA[T/G]
GCTGCAAAAGCTATCTTGGTTGATTTGGGATGACTTGTTTTTACCATGGTCATTCTCTTGGCGTGTTATATGCCTACTTTAATTGTGGTAAGAGTCATAG

Reverse complement sequence

CTATGACTCTTACCACAATTAAAGTAGGCATATAACACGCCAAGAGAATGACCATGGTAAAAACAAGTCATCCCAAATCAACCAAGATAGCTTTTGCAGC[A/C]
TAAAAAAGCTTACAAAAATAGTATAACACTTTTCTGTCGGGTACCTTTTAATTTGCATGGTAATAATTCCAAAGAATTATATAACCGCATTAAAAAGGAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.60% 10.30% 12.38% 33.64% NA
All Indica  2759 30.90% 1.20% 16.82% 51.11% NA
All Japonica  1512 67.90% 29.40% 0.66% 2.05% NA
Aus  269 33.80% 0.40% 25.28% 40.52% NA
Indica I  595 15.10% 1.00% 30.25% 53.61% NA
Indica II  465 39.40% 1.30% 10.54% 48.82% NA
Indica III  913 39.00% 0.10% 9.97% 50.93% NA
Indica Intermediate  786 28.50% 2.40% 18.32% 50.76% NA
Temperate Japonica  767 45.10% 54.40% 0.26% 0.26% NA
Tropical Japonica  504 92.70% 1.40% 0.79% 5.16% NA
Japonica Intermediate  241 88.40% 8.70% 1.66% 1.24% NA
VI/Aromatic  96 57.30% 0.00% 34.38% 8.33% NA
Intermediate  90 41.10% 12.20% 11.11% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401805399 T -> DEL N N silent_mutation Average:23.157; most accessible tissue: Minghui63 young leaf, score: 43.347 N N N N
vg0401805399 T -> G LOC_Os04g03950.1 upstream_gene_variant ; 478.0bp to feature; MODIFIER silent_mutation Average:23.157; most accessible tissue: Minghui63 young leaf, score: 43.347 N N N N
vg0401805399 T -> G LOC_Os04g03970.1 upstream_gene_variant ; 3070.0bp to feature; MODIFIER silent_mutation Average:23.157; most accessible tissue: Minghui63 young leaf, score: 43.347 N N N N
vg0401805399 T -> G LOC_Os04g03940.1 downstream_gene_variant ; 4700.0bp to feature; MODIFIER silent_mutation Average:23.157; most accessible tissue: Minghui63 young leaf, score: 43.347 N N N N
vg0401805399 T -> G LOC_Os04g03960.1 downstream_gene_variant ; 1110.0bp to feature; MODIFIER silent_mutation Average:23.157; most accessible tissue: Minghui63 young leaf, score: 43.347 N N N N
vg0401805399 T -> G LOC_Os04g03950-LOC_Os04g03960 intergenic_region ; MODIFIER silent_mutation Average:23.157; most accessible tissue: Minghui63 young leaf, score: 43.347 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401805399 NA 2.54E-06 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401805399 NA 2.09E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401805399 NA 6.59E-06 mr1650 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401805399 NA 1.74E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401805399 NA 3.10E-07 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401805399 NA 2.29E-07 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401805399 NA 1.17E-06 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401805399 2.32E-06 NA mr1933_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251