\
| Variant ID: vg0401805399 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 1805399 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, T: 0.03, others allele: 0.00, population size: 99. )
ATCCTTTTTAATGCGGTTATATAATTCTTTGGAATTATTACCATGCAAATTAAAAGGTACCCGACAGAAAAGTGTTATACTATTTTTGTAAGCTTTTTTA[T/G]
GCTGCAAAAGCTATCTTGGTTGATTTGGGATGACTTGTTTTTACCATGGTCATTCTCTTGGCGTGTTATATGCCTACTTTAATTGTGGTAAGAGTCATAG
CTATGACTCTTACCACAATTAAAGTAGGCATATAACACGCCAAGAGAATGACCATGGTAAAAACAAGTCATCCCAAATCAACCAAGATAGCTTTTGCAGC[A/C]
TAAAAAAGCTTACAAAAATAGTATAACACTTTTCTGTCGGGTACCTTTTAATTTGCATGGTAATAATTCCAAAGAATTATATAACCGCATTAAAAAGGAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.60% | 10.30% | 12.38% | 33.64% | NA |
| All Indica | 2759 | 30.90% | 1.20% | 16.82% | 51.11% | NA |
| All Japonica | 1512 | 67.90% | 29.40% | 0.66% | 2.05% | NA |
| Aus | 269 | 33.80% | 0.40% | 25.28% | 40.52% | NA |
| Indica I | 595 | 15.10% | 1.00% | 30.25% | 53.61% | NA |
| Indica II | 465 | 39.40% | 1.30% | 10.54% | 48.82% | NA |
| Indica III | 913 | 39.00% | 0.10% | 9.97% | 50.93% | NA |
| Indica Intermediate | 786 | 28.50% | 2.40% | 18.32% | 50.76% | NA |
| Temperate Japonica | 767 | 45.10% | 54.40% | 0.26% | 0.26% | NA |
| Tropical Japonica | 504 | 92.70% | 1.40% | 0.79% | 5.16% | NA |
| Japonica Intermediate | 241 | 88.40% | 8.70% | 1.66% | 1.24% | NA |
| VI/Aromatic | 96 | 57.30% | 0.00% | 34.38% | 8.33% | NA |
| Intermediate | 90 | 41.10% | 12.20% | 11.11% | 35.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0401805399 | T -> DEL | N | N | silent_mutation | Average:23.157; most accessible tissue: Minghui63 young leaf, score: 43.347 | N | N | N | N |
| vg0401805399 | T -> G | LOC_Os04g03950.1 | upstream_gene_variant ; 478.0bp to feature; MODIFIER | silent_mutation | Average:23.157; most accessible tissue: Minghui63 young leaf, score: 43.347 | N | N | N | N |
| vg0401805399 | T -> G | LOC_Os04g03970.1 | upstream_gene_variant ; 3070.0bp to feature; MODIFIER | silent_mutation | Average:23.157; most accessible tissue: Minghui63 young leaf, score: 43.347 | N | N | N | N |
| vg0401805399 | T -> G | LOC_Os04g03940.1 | downstream_gene_variant ; 4700.0bp to feature; MODIFIER | silent_mutation | Average:23.157; most accessible tissue: Minghui63 young leaf, score: 43.347 | N | N | N | N |
| vg0401805399 | T -> G | LOC_Os04g03960.1 | downstream_gene_variant ; 1110.0bp to feature; MODIFIER | silent_mutation | Average:23.157; most accessible tissue: Minghui63 young leaf, score: 43.347 | N | N | N | N |
| vg0401805399 | T -> G | LOC_Os04g03950-LOC_Os04g03960 | intergenic_region ; MODIFIER | silent_mutation | Average:23.157; most accessible tissue: Minghui63 young leaf, score: 43.347 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0401805399 | NA | 2.54E-06 | mr1182 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401805399 | NA | 2.09E-06 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401805399 | NA | 6.59E-06 | mr1650 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401805399 | NA | 1.74E-07 | mr1805 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401805399 | NA | 3.10E-07 | mr1880 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401805399 | NA | 2.29E-07 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401805399 | NA | 1.17E-06 | mr1229_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401805399 | 2.32E-06 | NA | mr1933_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |