\
| Variant ID: vg0401802995 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 1802995 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.06, others allele: 0.00, population size: 209. )
TTCACAGTTAAGTCTTGCTGAGAAGGAAACAAGGTCGTCAAAGACAGCCACTCGGGAGACTTACATTTACAATGCGGGTAGCTTCTCCGAGTGCTTTCTT[T/C]
AGCTGGCGCACCTCTTCGTCTTCCTTTTGTCGGTTTATGACGATGCCCGCAGGTTGCAAGTTGTTGTCCCACCATTTGATTAAGATGGGGGGACGAGAAT
ATTCTCGTCCCCCCATCTTAATCAAATGGTGGGACAACAACTTGCAACCTGCGGGCATCGTCATAAACCGACAAAAGGAAGACGAAGAGGTGCGCCAGCT[A/G]
AAGAAAGCACTCGGAGAAGCTACCCGCATTGTAAATGTAAGTCTCCCGAGTGGCTGTCTTTGACGACCTTGTTTCCTTCTCAGCAAGACTTAACTGTGAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.60% | 15.20% | 5.76% | 29.45% | NA |
| All Indica | 2759 | 45.10% | 2.40% | 6.34% | 46.14% | NA |
| All Japonica | 1512 | 55.40% | 41.90% | 0.20% | 2.58% | NA |
| Aus | 269 | 43.10% | 1.90% | 34.20% | 20.82% | NA |
| Indica I | 595 | 32.10% | 2.90% | 10.25% | 54.79% | NA |
| Indica II | 465 | 50.10% | 2.80% | 3.87% | 43.23% | NA |
| Indica III | 913 | 52.40% | 0.20% | 4.05% | 43.37% | NA |
| Indica Intermediate | 786 | 43.60% | 4.30% | 7.51% | 44.53% | NA |
| Temperate Japonica | 767 | 26.20% | 72.00% | 0.26% | 1.56% | NA |
| Tropical Japonica | 504 | 90.90% | 4.20% | 0.20% | 4.76% | NA |
| Japonica Intermediate | 241 | 73.90% | 24.90% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 58.90% | 15.60% | 2.22% | 23.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0401802995 | T -> C | LOC_Os04g03950.1 | synonymous_variant ; p.Leu531Leu; LOW | synonymous_codon | Average:28.393; most accessible tissue: Minghui63 young leaf, score: 49.581 | N | N | N | N |
| vg0401802995 | T -> DEL | LOC_Os04g03950.1 | N | frameshift_variant | Average:28.393; most accessible tissue: Minghui63 young leaf, score: 49.581 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0401802995 | 2.72E-06 | 1.80E-14 | mr1182 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401802995 | NA | 3.01E-07 | mr1182 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401802995 | 8.90E-06 | 1.30E-12 | mr1282 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401802995 | NA | 3.26E-06 | mr1282 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401802995 | 4.73E-07 | 2.49E-15 | mr1650 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401802995 | NA | 6.22E-07 | mr1650 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401802995 | NA | 2.69E-11 | mr1658 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401802995 | NA | 1.14E-11 | mr1667 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401802995 | NA | 1.14E-06 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401802995 | 3.17E-06 | NA | mr1060_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401802995 | NA | 1.61E-06 | mr1693_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |