Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401795249:

Variant ID: vg0401795249 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 1795249
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

TATCTTTATTTGTATCTCGGGTTTGTTTCTTAACTTGTACGTCAAGGAAATACCCTGAGGTTTAGTCGGTTACGATTGTATTTTATCTGTATTCTCATAT[T/G]
CCGTTAGGGATATGAGTTATACCTTGTAATACGGACTCCTTCCCCTATATAAGGAGGGGTCCGAGTCCTTCCTGGGACACCAATTCTCTTGGAGATTATA

Reverse complement sequence

TATAATCTCCAAGAGAATTGGTGTCCCAGGAAGGACTCGGACCCCTCCTTATATAGGGGAAGGAGTCCGTATTACAAGGTATAACTCATATCCCTAACGG[A/C]
ATATGAGAATACAGATAAAATACAATCGTAACCGACTAAACCTCAGGGTATTTCCTTGACGTACAAGTTAAGAAACAAACCCGAGATACAAATAAAGATA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.10%	1.10%	3.64%	14.22%	NA
All Indica	2759	81.30%	1.70%	4.97%	12.00%	NA
All Japonica	1512	78.70%	0.00%	1.52%	19.78%	NA
Aus	269	87.70%	0.40%	2.97%	8.92%	NA
Indica I	595	75.60%	1.20%	4.37%	18.82%	NA
Indica II	465	79.60%	2.20%	5.38%	12.90%	NA
Indica III	913	84.70%	2.40%	4.93%	8.00%	NA
Indica Intermediate	786	82.70%	1.10%	5.22%	10.94%	NA
Temperate Japonica	767	80.60%	0.00%	0.39%	19.04%	NA
Tropical Japonica	504	80.00%	0.00%	1.59%	18.45%	NA
Japonica Intermediate	241	70.10%	0.00%	4.98%	24.90%	NA
VI/Aromatic	96	92.70%	0.00%	1.04%	6.25%	NA
Intermediate	90	82.20%	1.10%	3.33%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0401795249	T -> DEL	N	N	silent_mutation	Average:41.374; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0401795249	T -> G	LOC_Os04g03910.1	upstream_gene_variant ; 4790.0bp to feature; MODIFIER	silent_mutation	Average:41.374; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0401795249	T -> G	LOC_Os04g03920.1	upstream_gene_variant ; 2278.0bp to feature; MODIFIER	silent_mutation	Average:41.374; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0401795249	T -> G	LOC_Os04g03930.1	upstream_gene_variant ; 266.0bp to feature; MODIFIER	silent_mutation	Average:41.374; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0401795249	T -> G	LOC_Os04g03940.1	upstream_gene_variant ; 312.0bp to feature; MODIFIER	silent_mutation	Average:41.374; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0401795249	T -> G	LOC_Os04g03930-LOC_Os04g03940	intergenic_region ; MODIFIER	silent_mutation	Average:41.374; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0401795249	NA	3.60E-07	mr1076	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401795249	NA	3.00E-06	mr1103	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401795249	NA	1.95E-06	mr1104	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401795249	NA	4.28E-07	mr1145	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401795249	4.95E-06	4.67E-08	mr1436	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251