\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401784083:

Variant ID: vg0401784083 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 1784083
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTTCGTGTCCAACGTTTGACTGTCCGTCTTATATGAAATTTTTTTATAATTAGTATTTTCATTATTGTTAGATGATAAAATATGATTAATACTTTATGC[G/A]
TGACTTGTCTTTTTAATTTTTTCTATAATTTTTTCAAATAAGACGGACGGTCAAACGTTGGACACGGAAACCCAGGGTTTGTCTTCTTTTAGACGGTTTG

Reverse complement sequence

CAAACCGTCTAAAAGAAGACAAACCCTGGGTTTCCGTGTCCAACGTTTGACCGTCCGTCTTATTTGAAAAAATTATAGAAAAAATTAAAAAGACAAGTCA[C/T]
GCATAAAGTATTAATCATATTTTATCATCTAACAATAATGAAAATACTAATTATAAAAAAATTTCATATAAGACGGACAGTCAAACGTTGGACACGAAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.40% 9.10% 0.61% 45.90% NA
All Indica  2759 31.00% 0.70% 0.87% 67.45% NA
All Japonica  1512 70.60% 26.50% 0.07% 2.84% NA
Aus  269 32.70% 0.00% 0.00% 67.29% NA
Indica I  595 15.80% 0.20% 1.18% 82.86% NA
Indica II  465 39.40% 0.90% 0.65% 59.14% NA
Indica III  913 38.30% 0.80% 0.55% 60.35% NA
Indica Intermediate  786 29.10% 0.80% 1.15% 68.96% NA
Temperate Japonica  767 97.70% 2.10% 0.13% 0.13% NA
Tropical Japonica  504 29.00% 64.10% 0.00% 6.94% NA
Japonica Intermediate  241 71.40% 25.70% 0.00% 2.90% NA
VI/Aromatic  96 47.90% 4.20% 1.04% 46.88% NA
Intermediate  90 44.40% 8.90% 3.33% 43.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401784083 G -> DEL N N silent_mutation Average:42.765; most accessible tissue: Minghui63 root, score: 75.806 N N N N
vg0401784083 G -> A LOC_Os04g03890.1 upstream_gene_variant ; 2735.0bp to feature; MODIFIER silent_mutation Average:42.765; most accessible tissue: Minghui63 root, score: 75.806 N N N N
vg0401784083 G -> A LOC_Os04g03910.1 downstream_gene_variant ; 4481.0bp to feature; MODIFIER silent_mutation Average:42.765; most accessible tissue: Minghui63 root, score: 75.806 N N N N
vg0401784083 G -> A LOC_Os04g03890-LOC_Os04g03910 intergenic_region ; MODIFIER silent_mutation Average:42.765; most accessible tissue: Minghui63 root, score: 75.806 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401784083 1.79E-06 NA mr1213 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401784083 NA 2.01E-08 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401784083 NA 8.89E-06 mr1225 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401784083 NA 2.13E-10 mr1235 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401784083 NA 6.23E-06 mr1246 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401784083 4.82E-09 1.02E-30 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401784083 NA 1.07E-18 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401784083 3.62E-08 1.76E-22 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401784083 NA 2.18E-15 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401784083 NA 1.22E-08 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401784083 NA 1.21E-06 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401784083 NA 3.06E-14 mr1771 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401784083 NA 7.61E-07 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401784083 1.99E-11 3.61E-34 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401784083 NA 7.65E-23 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401784083 NA 3.43E-10 mr1398_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401784083 NA 5.38E-06 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401784083 2.82E-07 5.20E-23 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401784083 NA 9.72E-16 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401784083 NA 2.06E-07 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401784083 5.42E-06 1.33E-15 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401784083 NA 5.49E-16 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251