Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0401783628:

Variant ID: vg0401783628 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 1783628
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGCCCATGTGAGCTGTGTTCATTTTTATGGATAAATAAATTGGAGTGACTCATGCATGTATCACTCCCTCCGTTTATAAAATAGGCCGTGTTTAGTTCCC[C/T]
AAATTCCCAACTTTCCATCACATCACATTACATCACATCGAAAATTTTCCTACACACATAAACTACAACTTTTTCTTCAAACTACCAACTTTCTCTAAAC

Reverse complement sequence

GTTTAGAGAAAGTTGGTAGTTTGAAGAAAAAGTTGTAGTTTATGTGTGTAGGAAAATTTTCGATGTGATGTAATGTGATGTGATGGAAAGTTGGGAATTT[G/A]
GGGAACTAAACACGGCCTATTTTATAAACGGAGGGAGTGATACATGCATGAGTCACTCCAATTTATTTATCCATAAAAATGAACACAGCTCACATGGGCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.30%	11.40%	1.35%	44.96%	NA
All Indica	2759	27.40%	4.60%	2.14%	65.89%	NA
All Japonica	1512	71.30%	25.90%	0.07%	2.78%	NA
Aus	269	32.70%	0.00%	0.37%	66.91%	NA
Indica I	595	15.00%	0.70%	3.70%	80.67%	NA
Indica II	465	39.40%	0.60%	1.08%	58.92%	NA
Indica III	913	30.10%	9.30%	1.75%	58.82%	NA
Indica Intermediate	786	26.50%	4.50%	2.04%	67.05%	NA
Temperate Japonica	767	76.30%	23.50%	0.13%	0.13%	NA
Tropical Japonica	504	71.80%	21.40%	0.00%	6.75%	NA
Japonica Intermediate	241	54.40%	42.70%	0.00%	2.90%	NA
VI/Aromatic	96	45.80%	7.30%	0.00%	46.88%	NA
Intermediate	90	36.70%	15.60%	3.33%	44.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0401783628	C -> DEL	N	N	silent_mutation	Average:43.002; most accessible tissue: Minghui63 root, score: 91.863	N	N	N	N
vg0401783628	C -> T	LOC_Os04g03890.1	upstream_gene_variant ; 2280.0bp to feature; MODIFIER	silent_mutation	Average:43.002; most accessible tissue: Minghui63 root, score: 91.863	N	N	N	N
vg0401783628	C -> T	LOC_Os04g03910.1	downstream_gene_variant ; 4936.0bp to feature; MODIFIER	silent_mutation	Average:43.002; most accessible tissue: Minghui63 root, score: 91.863	N	N	N	N
vg0401783628	C -> T	LOC_Os04g03890-LOC_Os04g03910	intergenic_region ; MODIFIER	silent_mutation	Average:43.002; most accessible tissue: Minghui63 root, score: 91.863	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0401783628	C	T	-0.15	0.0	-0.01	0.0	-0.01	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0401783628	3.90E-06	NA	mr1924	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251