\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401783628:

Variant ID: vg0401783628 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 1783628
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCCCATGTGAGCTGTGTTCATTTTTATGGATAAATAAATTGGAGTGACTCATGCATGTATCACTCCCTCCGTTTATAAAATAGGCCGTGTTTAGTTCCC[C/T]
AAATTCCCAACTTTCCATCACATCACATTACATCACATCGAAAATTTTCCTACACACATAAACTACAACTTTTTCTTCAAACTACCAACTTTCTCTAAAC

Reverse complement sequence

GTTTAGAGAAAGTTGGTAGTTTGAAGAAAAAGTTGTAGTTTATGTGTGTAGGAAAATTTTCGATGTGATGTAATGTGATGTGATGGAAAGTTGGGAATTT[G/A]
GGGAACTAAACACGGCCTATTTTATAAACGGAGGGAGTGATACATGCATGAGTCACTCCAATTTATTTATCCATAAAAATGAACACAGCTCACATGGGCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.30% 11.40% 1.35% 44.96% NA
All Indica  2759 27.40% 4.60% 2.14% 65.89% NA
All Japonica  1512 71.30% 25.90% 0.07% 2.78% NA
Aus  269 32.70% 0.00% 0.37% 66.91% NA
Indica I  595 15.00% 0.70% 3.70% 80.67% NA
Indica II  465 39.40% 0.60% 1.08% 58.92% NA
Indica III  913 30.10% 9.30% 1.75% 58.82% NA
Indica Intermediate  786 26.50% 4.50% 2.04% 67.05% NA
Temperate Japonica  767 76.30% 23.50% 0.13% 0.13% NA
Tropical Japonica  504 71.80% 21.40% 0.00% 6.75% NA
Japonica Intermediate  241 54.40% 42.70% 0.00% 2.90% NA
VI/Aromatic  96 45.80% 7.30% 0.00% 46.88% NA
Intermediate  90 36.70% 15.60% 3.33% 44.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401783628 C -> DEL N N silent_mutation Average:43.002; most accessible tissue: Minghui63 root, score: 91.863 N N N N
vg0401783628 C -> T LOC_Os04g03890.1 upstream_gene_variant ; 2280.0bp to feature; MODIFIER silent_mutation Average:43.002; most accessible tissue: Minghui63 root, score: 91.863 N N N N
vg0401783628 C -> T LOC_Os04g03910.1 downstream_gene_variant ; 4936.0bp to feature; MODIFIER silent_mutation Average:43.002; most accessible tissue: Minghui63 root, score: 91.863 N N N N
vg0401783628 C -> T LOC_Os04g03890-LOC_Os04g03910 intergenic_region ; MODIFIER silent_mutation Average:43.002; most accessible tissue: Minghui63 root, score: 91.863 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0401783628 C T -0.15 0.0 -0.01 0.0 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401783628 3.90E-06 NA mr1924 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251