\
| Variant ID: vg0401779398 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 1779398 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CTCGTCGAGATCTACAATTTTTATATAAATTTTATTTTTTACGATGTCTTTTAAAATGTATATTTAATATTTTGTTAAAATAGGTTTTAGATTTTGTAAC[G/C]
AACATATGGACATGTAAAAAATCTTAAATGAAATAGTTGTTAATTACAAAGTTGTAGAAATAGTTGTTAATTACAAGTTGTATATATCTTTTCAAGTTCT
AGAACTTGAAAAGATATATACAACTTGTAATTAACAACTATTTCTACAACTTTGTAATTAACAACTATTTCATTTAAGATTTTTTACATGTCCATATGTT[C/G]
GTTACAAAATCTAAAACCTATTTTAACAAAATATTAAATATACATTTTAAAAGACATCGTAAAAAATAAAATTTATATAAAAATTGTAGATCTCGACGAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.90% | 1.90% | 10.85% | 19.36% | NA |
| All Indica | 2759 | 56.10% | 0.10% | 17.54% | 26.28% | NA |
| All Japonica | 1512 | 81.90% | 5.80% | 0.79% | 11.51% | NA |
| Aus | 269 | 97.00% | 0.00% | 1.49% | 1.49% | NA |
| Indica I | 595 | 31.90% | 0.00% | 22.02% | 46.05% | NA |
| Indica II | 465 | 61.50% | 0.40% | 18.06% | 20.00% | NA |
| Indica III | 913 | 69.60% | 0.00% | 11.94% | 18.51% | NA |
| Indica Intermediate | 786 | 55.50% | 0.10% | 20.36% | 24.05% | NA |
| Temperate Japonica | 767 | 83.10% | 9.90% | 0.13% | 6.91% | NA |
| Tropical Japonica | 504 | 93.70% | 1.20% | 0.40% | 4.76% | NA |
| Japonica Intermediate | 241 | 53.90% | 2.10% | 3.73% | 40.25% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 1.10% | 12.22% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0401779398 | G -> C | LOC_Os04g03884.1 | downstream_gene_variant ; 1102.0bp to feature; MODIFIER | silent_mutation | Average:44.04; most accessible tissue: Minghui63 flower, score: 76.594 | N | N | N | N |
| vg0401779398 | G -> C | LOC_Os04g03890.1 | downstream_gene_variant ; 496.0bp to feature; MODIFIER | silent_mutation | Average:44.04; most accessible tissue: Minghui63 flower, score: 76.594 | N | N | N | N |
| vg0401779398 | G -> C | LOC_Os04g03884-LOC_Os04g03890 | intergenic_region ; MODIFIER | silent_mutation | Average:44.04; most accessible tissue: Minghui63 flower, score: 76.594 | N | N | N | N |
| vg0401779398 | G -> DEL | N | N | silent_mutation | Average:44.04; most accessible tissue: Minghui63 flower, score: 76.594 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0401779398 | NA | 9.31E-08 | mr1613 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401779398 | NA | 1.56E-06 | mr1619 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401779398 | 9.20E-07 | 9.20E-07 | mr1795 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401779398 | NA | 4.30E-07 | mr1962 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401779398 | 6.55E-07 | 6.55E-07 | mr1024_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401779398 | 1.88E-07 | 1.71E-09 | mr1565_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401779398 | 7.83E-07 | 7.83E-07 | mr1915_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401779398 | NA | 1.60E-06 | mr1922_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401779398 | 9.87E-09 | 9.87E-09 | mr1940_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |