\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401779398:

Variant ID: vg0401779398 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 1779398
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCGTCGAGATCTACAATTTTTATATAAATTTTATTTTTTACGATGTCTTTTAAAATGTATATTTAATATTTTGTTAAAATAGGTTTTAGATTTTGTAAC[G/C]
AACATATGGACATGTAAAAAATCTTAAATGAAATAGTTGTTAATTACAAAGTTGTAGAAATAGTTGTTAATTACAAGTTGTATATATCTTTTCAAGTTCT

Reverse complement sequence

AGAACTTGAAAAGATATATACAACTTGTAATTAACAACTATTTCTACAACTTTGTAATTAACAACTATTTCATTTAAGATTTTTTACATGTCCATATGTT[C/G]
GTTACAAAATCTAAAACCTATTTTAACAAAATATTAAATATACATTTTAAAAGACATCGTAAAAAATAAAATTTATATAAAAATTGTAGATCTCGACGAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.90% 1.90% 10.85% 19.36% NA
All Indica  2759 56.10% 0.10% 17.54% 26.28% NA
All Japonica  1512 81.90% 5.80% 0.79% 11.51% NA
Aus  269 97.00% 0.00% 1.49% 1.49% NA
Indica I  595 31.90% 0.00% 22.02% 46.05% NA
Indica II  465 61.50% 0.40% 18.06% 20.00% NA
Indica III  913 69.60% 0.00% 11.94% 18.51% NA
Indica Intermediate  786 55.50% 0.10% 20.36% 24.05% NA
Temperate Japonica  767 83.10% 9.90% 0.13% 6.91% NA
Tropical Japonica  504 93.70% 1.20% 0.40% 4.76% NA
Japonica Intermediate  241 53.90% 2.10% 3.73% 40.25% NA
VI/Aromatic  96 97.90% 0.00% 2.08% 0.00% NA
Intermediate  90 73.30% 1.10% 12.22% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401779398 G -> C LOC_Os04g03884.1 downstream_gene_variant ; 1102.0bp to feature; MODIFIER silent_mutation Average:44.04; most accessible tissue: Minghui63 flower, score: 76.594 N N N N
vg0401779398 G -> C LOC_Os04g03890.1 downstream_gene_variant ; 496.0bp to feature; MODIFIER silent_mutation Average:44.04; most accessible tissue: Minghui63 flower, score: 76.594 N N N N
vg0401779398 G -> C LOC_Os04g03884-LOC_Os04g03890 intergenic_region ; MODIFIER silent_mutation Average:44.04; most accessible tissue: Minghui63 flower, score: 76.594 N N N N
vg0401779398 G -> DEL N N silent_mutation Average:44.04; most accessible tissue: Minghui63 flower, score: 76.594 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401779398 NA 9.31E-08 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401779398 NA 1.56E-06 mr1619 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401779398 9.20E-07 9.20E-07 mr1795 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401779398 NA 4.30E-07 mr1962 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401779398 6.55E-07 6.55E-07 mr1024_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401779398 1.88E-07 1.71E-09 mr1565_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401779398 7.83E-07 7.83E-07 mr1915_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401779398 NA 1.60E-06 mr1922_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401779398 9.87E-09 9.87E-09 mr1940_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251