Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0401779398:

Variant ID: vg0401779398 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 1779398
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTCGTCGAGATCTACAATTTTTATATAAATTTTATTTTTTACGATGTCTTTTAAAATGTATATTTAATATTTTGTTAAAATAGGTTTTAGATTTTGTAAC[G/C]
AACATATGGACATGTAAAAAATCTTAAATGAAATAGTTGTTAATTACAAAGTTGTAGAAATAGTTGTTAATTACAAGTTGTATATATCTTTTCAAGTTCT

Reverse complement sequence

AGAACTTGAAAAGATATATACAACTTGTAATTAACAACTATTTCTACAACTTTGTAATTAACAACTATTTCATTTAAGATTTTTTACATGTCCATATGTT[C/G]
GTTACAAAATCTAAAACCTATTTTAACAAAATATTAAATATACATTTTAAAAGACATCGTAAAAAATAAAATTTATATAAAAATTGTAGATCTCGACGAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.90%	1.90%	10.85%	19.36%	NA
All Indica	2759	56.10%	0.10%	17.54%	26.28%	NA
All Japonica	1512	81.90%	5.80%	0.79%	11.51%	NA
Aus	269	97.00%	0.00%	1.49%	1.49%	NA
Indica I	595	31.90%	0.00%	22.02%	46.05%	NA
Indica II	465	61.50%	0.40%	18.06%	20.00%	NA
Indica III	913	69.60%	0.00%	11.94%	18.51%	NA
Indica Intermediate	786	55.50%	0.10%	20.36%	24.05%	NA
Temperate Japonica	767	83.10%	9.90%	0.13%	6.91%	NA
Tropical Japonica	504	93.70%	1.20%	0.40%	4.76%	NA
Japonica Intermediate	241	53.90%	2.10%	3.73%	40.25%	NA
VI/Aromatic	96	97.90%	0.00%	2.08%	0.00%	NA
Intermediate	90	73.30%	1.10%	12.22%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0401779398	G -> C	LOC_Os04g03884.1	downstream_gene_variant ; 1102.0bp to feature; MODIFIER	silent_mutation	Average:44.04; most accessible tissue: Minghui63 flower, score: 76.594	N	N	N	N
vg0401779398	G -> C	LOC_Os04g03890.1	downstream_gene_variant ; 496.0bp to feature; MODIFIER	silent_mutation	Average:44.04; most accessible tissue: Minghui63 flower, score: 76.594	N	N	N	N
vg0401779398	G -> C	LOC_Os04g03884-LOC_Os04g03890	intergenic_region ; MODIFIER	silent_mutation	Average:44.04; most accessible tissue: Minghui63 flower, score: 76.594	N	N	N	N
vg0401779398	G -> DEL	N	N	silent_mutation	Average:44.04; most accessible tissue: Minghui63 flower, score: 76.594	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0401779398	NA	9.31E-08	mr1613	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401779398	NA	1.56E-06	mr1619	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401779398	9.20E-07	9.20E-07	mr1795	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401779398	NA	4.30E-07	mr1962	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401779398	6.55E-07	6.55E-07	mr1024_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401779398	1.88E-07	1.71E-09	mr1565_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401779398	7.83E-07	7.83E-07	mr1915_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401779398	NA	1.60E-06	mr1922_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401779398	9.87E-09	9.87E-09	mr1940_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251