\
| Variant ID: vg0401777097 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 1777097 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.72, T: 0.27, others allele: 0.00, population size: 123. )
AGCGATTCATTAATATTTACATTTCTCGATGCCCATGCAACCAATCTTGTGTGGAAGAATGAAGAGTCATGCATTAAATCCAAGAAAGTCATTAAGATGA[A/T]
AAGTTGTTGGATTGAAATATGACTATCAAAAATAAAATTTTCAGATTTGGAAATATGACTATCAAAAGTAGATGGAGGGAGTATTTGTACCCAATTCTAG
CTAGAATTGGGTACAAATACTCCCTCCATCTACTTTTGATAGTCATATTTCCAAATCTGAAAATTTTATTTTTGATAGTCATATTTCAATCCAACAACTT[T/A]
TCATCTTAATGACTTTCTTGGATTTAATGCATGACTCTTCATTCTTCCACACAAGATTGGTTGCATGGGCATCGAGAAATGTAAATATTAATGAATCGCT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.20% | 2.60% | 2.31% | 47.86% | NA |
| All Indica | 2759 | 27.70% | 4.30% | 2.39% | 65.64% | NA |
| All Japonica | 1512 | 84.10% | 0.10% | 0.26% | 15.48% | NA |
| Aus | 269 | 33.80% | 0.00% | 11.52% | 54.65% | NA |
| Indica I | 595 | 15.80% | 0.30% | 0.84% | 83.03% | NA |
| Indica II | 465 | 41.50% | 0.40% | 1.51% | 56.56% | NA |
| Indica III | 913 | 29.80% | 9.20% | 4.16% | 56.85% | NA |
| Indica Intermediate | 786 | 26.10% | 3.80% | 2.04% | 68.07% | NA |
| Temperate Japonica | 767 | 92.00% | 0.00% | 0.13% | 7.82% | NA |
| Tropical Japonica | 504 | 88.90% | 0.40% | 0.20% | 10.52% | NA |
| Japonica Intermediate | 241 | 49.00% | 0.00% | 0.83% | 50.21% | NA |
| VI/Aromatic | 96 | 56.20% | 3.10% | 6.25% | 34.38% | NA |
| Intermediate | 90 | 54.40% | 2.20% | 2.22% | 41.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0401777097 | A -> DEL | N | N | silent_mutation | Average:30.226; most accessible tissue: Minghui63 flower, score: 57.187 | N | N | N | N |
| vg0401777097 | A -> T | LOC_Os04g03884.1 | 3_prime_UTR_variant ; 253.0bp to feature; MODIFIER | silent_mutation | Average:30.226; most accessible tissue: Minghui63 flower, score: 57.187 | N | N | N | N |
| vg0401777097 | A -> T | LOC_Os04g03880.1 | upstream_gene_variant ; 3189.0bp to feature; MODIFIER | silent_mutation | Average:30.226; most accessible tissue: Minghui63 flower, score: 57.187 | N | N | N | N |
| vg0401777097 | A -> T | LOC_Os04g03890.1 | downstream_gene_variant ; 2797.0bp to feature; MODIFIER | silent_mutation | Average:30.226; most accessible tissue: Minghui63 flower, score: 57.187 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0401777097 | NA | 7.22E-06 | mr1919 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |