\
| Variant ID: vg0401764682 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 1764682 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GACGAATTCCCCCGCTCCGCCGTCTTTCCCATCTCCGGCAGCACCCCCACTGCCAGCCTCCATATCCCCGCAACTTCACTAGTGCCACTACCGACTCACC[G/A]
TCCGTTCATTCCATCACCCACCAACAACATCGTCCTCTATGGGCCAATGACTCCCCTTCTCTGATCTTCTTCTGGTCCGTGTACCACCATCTTGCCTGAG
CTCAGGCAAGATGGTGGTACACGGACCAGAAGAAGATCAGAGAAGGGGAGTCATTGGCCCATAGAGGACGATGTTGTTGGTGGGTGATGGAATGAACGGA[C/T]
GGTGAGTCGGTAGTGGCACTAGTGAAGTTGCGGGGATATGGAGGCTGGCAGTGGGGGTGCTGCCGGAGATGGGAAAGACGGCGGAGCGGGGGAATTCGTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.80% | 1.70% | 0.51% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 93.60% | 5.00% | 1.46% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 81.50% | 14.50% | 3.97% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.80% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0401764682 | G -> A | LOC_Os04g03860.1 | downstream_gene_variant ; 4817.0bp to feature; MODIFIER | silent_mutation | Average:57.533; most accessible tissue: Zhenshan97 young leaf, score: 82.31 | N | N | N | N |
| vg0401764682 | G -> A | LOC_Os04g03870.1 | downstream_gene_variant ; 2325.0bp to feature; MODIFIER | silent_mutation | Average:57.533; most accessible tissue: Zhenshan97 young leaf, score: 82.31 | N | N | N | N |
| vg0401764682 | G -> A | LOC_Os04g03860-LOC_Os04g03870 | intergenic_region ; MODIFIER | silent_mutation | Average:57.533; most accessible tissue: Zhenshan97 young leaf, score: 82.31 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0401764682 | NA | 9.35E-06 | mr1076 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401764682 | NA | 1.85E-06 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401764682 | NA | 4.45E-06 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401764682 | 5.66E-06 | NA | mr1301 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401764682 | NA | 8.89E-06 | mr1798 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401764682 | 1.90E-06 | 4.64E-09 | mr1082_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401764682 | NA | 8.57E-07 | mr1083_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401764682 | NA | 4.50E-08 | mr1798_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |