Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401764682:

Variant ID: vg0401764682 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 1764682
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GACGAATTCCCCCGCTCCGCCGTCTTTCCCATCTCCGGCAGCACCCCCACTGCCAGCCTCCATATCCCCGCAACTTCACTAGTGCCACTACCGACTCACC[G/A]
TCCGTTCATTCCATCACCCACCAACAACATCGTCCTCTATGGGCCAATGACTCCCCTTCTCTGATCTTCTTCTGGTCCGTGTACCACCATCTTGCCTGAG

Reverse complement sequence

CTCAGGCAAGATGGTGGTACACGGACCAGAAGAAGATCAGAGAAGGGGAGTCATTGGCCCATAGAGGACGATGTTGTTGGTGGGTGATGGAATGAACGGA[C/T]
GGTGAGTCGGTAGTGGCACTAGTGAAGTTGCGGGGATATGGAGGCTGGCAGTGGGGGTGCTGCCGGAGATGGGAAAGACGGCGGAGCGGGGGAATTCGTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.80%	1.70%	0.51%	0.00%	NA
All Indica	2759	99.90%	0.10%	0.07%	0.00%	NA
All Japonica	1512	93.60%	5.00%	1.46%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.60%	0.20%	0.22%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.10%	0.13%	0.00%	NA
Temperate Japonica	767	99.90%	0.00%	0.13%	0.00%	NA
Tropical Japonica	504	81.50%	14.50%	3.97%	0.00%	NA
Japonica Intermediate	241	98.80%	0.80%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	5.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0401764682	G -> A	LOC_Os04g03860.1	downstream_gene_variant ; 4817.0bp to feature; MODIFIER	silent_mutation	Average:57.533; most accessible tissue: Zhenshan97 young leaf, score: 82.31	N	N	N	N
vg0401764682	G -> A	LOC_Os04g03870.1	downstream_gene_variant ; 2325.0bp to feature; MODIFIER	silent_mutation	Average:57.533; most accessible tissue: Zhenshan97 young leaf, score: 82.31	N	N	N	N
vg0401764682	G -> A	LOC_Os04g03860-LOC_Os04g03870	intergenic_region ; MODIFIER	silent_mutation	Average:57.533; most accessible tissue: Zhenshan97 young leaf, score: 82.31	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0401764682	NA	9.35E-06	mr1076	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401764682	NA	1.85E-06	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401764682	NA	4.45E-06	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401764682	5.66E-06	NA	mr1301	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401764682	NA	8.89E-06	mr1798	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401764682	1.90E-06	4.64E-09	mr1082_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401764682	NA	8.57E-07	mr1083_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401764682	NA	4.50E-08	mr1798_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251