\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401764682:

Variant ID: vg0401764682 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 1764682
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GACGAATTCCCCCGCTCCGCCGTCTTTCCCATCTCCGGCAGCACCCCCACTGCCAGCCTCCATATCCCCGCAACTTCACTAGTGCCACTACCGACTCACC[G/A]
TCCGTTCATTCCATCACCCACCAACAACATCGTCCTCTATGGGCCAATGACTCCCCTTCTCTGATCTTCTTCTGGTCCGTGTACCACCATCTTGCCTGAG

Reverse complement sequence

CTCAGGCAAGATGGTGGTACACGGACCAGAAGAAGATCAGAGAAGGGGAGTCATTGGCCCATAGAGGACGATGTTGTTGGTGGGTGATGGAATGAACGGA[C/T]
GGTGAGTCGGTAGTGGCACTAGTGAAGTTGCGGGGATATGGAGGCTGGCAGTGGGGGTGCTGCCGGAGATGGGAAAGACGGCGGAGCGGGGGAATTCGTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.80% 1.70% 0.51% 0.00% NA
All Indica  2759 99.90% 0.10% 0.07% 0.00% NA
All Japonica  1512 93.60% 5.00% 1.46% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.20% 0.22% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.10% 0.13% 0.00% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 81.50% 14.50% 3.97% 0.00% NA
Japonica Intermediate  241 98.80% 0.80% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401764682 G -> A LOC_Os04g03860.1 downstream_gene_variant ; 4817.0bp to feature; MODIFIER silent_mutation Average:57.533; most accessible tissue: Zhenshan97 young leaf, score: 82.31 N N N N
vg0401764682 G -> A LOC_Os04g03870.1 downstream_gene_variant ; 2325.0bp to feature; MODIFIER silent_mutation Average:57.533; most accessible tissue: Zhenshan97 young leaf, score: 82.31 N N N N
vg0401764682 G -> A LOC_Os04g03860-LOC_Os04g03870 intergenic_region ; MODIFIER silent_mutation Average:57.533; most accessible tissue: Zhenshan97 young leaf, score: 82.31 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401764682 NA 9.35E-06 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401764682 NA 1.85E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401764682 NA 4.45E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401764682 5.66E-06 NA mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401764682 NA 8.89E-06 mr1798 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401764682 1.90E-06 4.64E-09 mr1082_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401764682 NA 8.57E-07 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401764682 NA 4.50E-08 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251