\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401738570:

Variant ID: vg0401738570 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 1738570
Reference Allele: AAlternative Allele: G,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATCAGGTATCTGGTCAGAGTCTGCAAGCTTTAGCGATGATGGGCTTGGTCCTGTGCCTTCCAAGTGGAAAGGCACATGTCAAGCTGGGCAAGAATTCAA[A/G,T]
TCTAACCTGTGCAACAGGAAGATAATTGGAGCTCGATGGTATGACGGGCATCTGAAGCCAAAGGATCTTGAGGGTGAGTACAGGTCGGCCAGGGATACTA

Reverse complement sequence

TAGTATCCCTGGCCGACCTGTACTCACCCTCAAGATCCTTTGGCTTCAGATGCCCGTCATACCATCGAGCTCCAATTATCTTCCTGTTGCACAGGTTAGA[T/C,A]
TTGAATTCTTGCCCAGCTTGACATGTGCCTTTCCACTTGGAAGGCACAGGACCAAGCCCATCATCGCTAAAGCTTGCAGACTCTGACCAGATACCTGATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.10% 11.30% 1.10% 9.50% NA
All Indica  2759 80.20% 4.30% 0.83% 14.72% NA
All Japonica  1512 72.00% 26.20% 1.65% 0.13% NA
Aus  269 95.90% 2.60% 0.37% 1.12% NA
Indica I  595 90.10% 2.40% 0.50% 7.06% NA
Indica II  465 66.50% 12.30% 0.86% 20.43% NA
Indica III  913 75.00% 1.50% 1.10% 22.34% NA
Indica Intermediate  786 86.80% 4.20% 0.76% 8.27% NA
Temperate Japonica  767 52.00% 47.70% 0.26% 0.00% NA
Tropical Japonica  504 94.40% 1.60% 3.97% 0.00% NA
Japonica Intermediate  241 88.80% 9.10% 1.24% 0.83% NA
VI/Aromatic  96 60.40% 0.00% 1.04% 38.54% NA
Intermediate  90 82.20% 14.40% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401738570 A -> DEL LOC_Os04g03850.1 N frameshift_variant Average:83.672; most accessible tissue: Minghui63 young leaf, score: 95.324 N N N N
vg0401738570 A -> G LOC_Os04g03850.1 synonymous_variant ; p.Lys61Lys; LOW synonymous_codon Average:83.672; most accessible tissue: Minghui63 young leaf, score: 95.324 N N N N
vg0401738570 A -> G LOC_Os04g03850.1 synonymous_variant ; p.Lys61Lys; LOW nonsynonymous_codon ; K61M Average:83.672; most accessible tissue: Minghui63 young leaf, score: 95.324 benign 0.728 DELETERIOUS 0.03
vg0401738570 A -> T LOC_Os04g03850.1 missense_variant ; p.Lys61Asn; MODERATE N Average:83.672; most accessible tissue: Minghui63 young leaf, score: 95.324 N N N N
vg0401738570 A -> T LOC_Os04g03840.1 upstream_gene_variant ; 4093.0bp to feature; MODIFIER N Average:83.672; most accessible tissue: Minghui63 young leaf, score: 95.324 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0401738570 A G 0.06 0.07 0.01 0.02 0.0 0.01
vg0401738570 A T -0.05 0.07 0.04 -0.03 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401738570 NA 6.77E-06 mr1062 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401738570 NA 4.77E-13 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401738570 NA 6.49E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401738570 NA 2.11E-07 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401738570 NA 1.78E-06 mr1282 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401738570 NA 6.11E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401738570 2.50E-06 1.55E-09 mr1525 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401738570 NA 1.87E-08 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401738570 NA 1.61E-07 mr1650 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401738570 NA 2.47E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401738570 NA 9.46E-06 mr1944 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401738570 NA 6.91E-09 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401738570 NA 1.02E-06 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401738570 NA 1.44E-06 mr1363_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251