\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401727352:

Variant ID: vg0401727352 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 1727352
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.67, T: 0.34, others allele: 0.00, population size: 177. )

Flanking Sequence (100 bp) in Reference Genome:


GTGAAAAAAAAACAGATTAACTTTTTGAATGTTTGTTGGTTTAGTGAAAGATCTTCTTCACTTCCTCCCTCTAGAGTGGGCCGAGTTAGTAACTTGAGAG[T/G]
CTGTTTGGCCGCAAGTTTGGTATAATAATATGACAATTATGCAGATATCTGATGACGCATATGACTACAAGTATTCAGAGGTTCTGTGGGGCATGCTTCG

Reverse complement sequence

CGAAGCATGCCCCACAGAACCTCTGAATACTTGTAGTCATATGCGTCATCAGATATCTGCATAATTGTCATATTATTATACCAAACTTGCGGCCAAACAG[A/C]
CTCTCAAGTTACTAACTCGGCCCACTCTAGAGGGAGGAAGTGAAGAAGATCTTTCACTAAACCAACAAACATTCAAAAAGTTAATCTGTTTTTTTTTCAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.60% 21.50% 0.74% 35.19% NA
All Indica  2759 44.50% 11.40% 0.76% 43.35% NA
All Japonica  1512 33.10% 40.90% 0.79% 25.13% NA
Aus  269 68.80% 21.60% 0.37% 9.29% NA
Indica I  595 18.50% 2.20% 1.34% 77.98% NA
Indica II  465 73.10% 4.50% 0.43% 21.94% NA
Indica III  913 48.00% 22.50% 0.33% 29.24% NA
Indica Intermediate  786 43.30% 9.50% 1.02% 46.18% NA
Temperate Japonica  767 5.50% 66.90% 0.78% 26.86% NA
Tropical Japonica  504 64.70% 11.50% 0.60% 23.21% NA
Japonica Intermediate  241 55.20% 19.90% 1.24% 23.65% NA
VI/Aromatic  96 59.40% 3.10% 1.04% 36.46% NA
Intermediate  90 47.80% 22.20% 0.00% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401727352 T -> DEL N N silent_mutation Average:35.989; most accessible tissue: Minghui63 flag leaf, score: 66.004 N N N N
vg0401727352 T -> G LOC_Os04g03830.1 downstream_gene_variant ; 55.0bp to feature; MODIFIER silent_mutation Average:35.989; most accessible tissue: Minghui63 flag leaf, score: 66.004 N N N N
vg0401727352 T -> G LOC_Os04g03830-LOC_Os04g03840 intergenic_region ; MODIFIER silent_mutation Average:35.989; most accessible tissue: Minghui63 flag leaf, score: 66.004 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401727352 NA 3.69E-07 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401727352 NA 4.19E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401727352 NA 1.66E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401727352 NA 1.49E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401727352 NA 1.04E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401727352 NA 5.47E-06 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401727352 NA 3.02E-06 mr1740 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401727352 NA 7.90E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401727352 NA 2.64E-07 mr1092_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401727352 NA 2.79E-08 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401727352 2.12E-06 1.78E-06 mr1128_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401727352 NA 3.82E-06 mr1129_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401727352 NA 1.95E-06 mr1148_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401727352 NA 9.89E-07 mr1152_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401727352 3.31E-06 6.41E-08 mr1154_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401727352 NA 6.76E-07 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401727352 NA 3.00E-07 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401727352 NA 7.06E-06 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401727352 NA 1.23E-06 mr1204_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401727352 NA 2.08E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401727352 NA 1.95E-08 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401727352 NA 8.57E-08 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401727352 NA 1.10E-08 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401727352 NA 4.24E-10 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401727352 NA 9.57E-07 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401727352 NA 6.35E-08 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401727352 NA 5.60E-06 mr1751_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401727352 NA 2.44E-09 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401727352 NA 5.78E-08 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401727352 NA 1.55E-06 mr1896_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251