\
| Variant ID: vg0401725165 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 1725165 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ACAGCGAGAACTGATCAGCTATCGTACGCTTGCGTGAGCAACAACAGTTTGTGTGTTCATAGATCTACTGGCTACCATTGCAAGTGCTCTTTGGGCTACG[G/A]
AGGAAATGCCTATATCGAAGATGGCTGTGAGGGTATGCTGTCTCTGATAAGCTTGATCGCTATCGTATTTACTATCTGACTGTTTTAAGGTACACCAAAT
ATTTGGTGTACCTTAAAACAGTCAGATAGTAAATACGATAGCGATCAAGCTTATCAGAGACAGCATACCCTCACAGCCATCTTCGATATAGGCATTTCCT[C/T]
CGTAGCCCAAAGAGCACTTGCAATGGTAGCCAGTAGATCTATGAACACACAAACTGTTGTTGCTCACGCAAGCGTACGATAGCTGATCAGTTCTCGCTGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.90% | 5.50% | 0.80% | 33.73% | NA |
| All Indica | 2759 | 52.80% | 4.60% | 0.91% | 41.65% | NA |
| All Japonica | 1512 | 75.20% | 0.30% | 0.73% | 23.81% | NA |
| Aus | 269 | 43.90% | 46.10% | 0.37% | 9.67% | NA |
| Indica I | 595 | 13.40% | 10.80% | 1.01% | 74.79% | NA |
| Indica II | 465 | 77.40% | 1.50% | 0.65% | 20.43% | NA |
| Indica III | 913 | 69.10% | 1.50% | 0.66% | 28.70% | NA |
| Indica Intermediate | 786 | 49.10% | 5.50% | 1.27% | 44.15% | NA |
| Temperate Japonica | 767 | 74.20% | 0.00% | 1.17% | 24.64% | NA |
| Tropical Japonica | 504 | 76.60% | 0.40% | 0.40% | 22.62% | NA |
| Japonica Intermediate | 241 | 75.50% | 0.80% | 0.00% | 23.65% | NA |
| VI/Aromatic | 96 | 60.40% | 4.20% | 1.04% | 34.38% | NA |
| Intermediate | 90 | 68.90% | 2.20% | 0.00% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0401725165 | G -> DEL | LOC_Os04g03830.1 | N | frameshift_variant | Average:30.311; most accessible tissue: Callus, score: 62.575 | N | N | N | N |
| vg0401725165 | G -> A | LOC_Os04g03830.1 | missense_variant ; p.Gly197Glu; MODERATE | nonsynonymous_codon ; G197E | Average:30.311; most accessible tissue: Callus, score: 62.575 | benign |
-0.208 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0401725165 | NA | 7.57E-07 | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401725165 | NA | 4.01E-06 | mr1048 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401725165 | NA | 7.19E-06 | mr1073 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401725165 | NA | 2.87E-07 | mr1126 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401725165 | NA | 3.93E-08 | mr1348 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401725165 | NA | 4.81E-06 | mr1353 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401725165 | NA | 9.92E-06 | mr1372 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401725165 | NA | 4.30E-06 | mr1382 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401725165 | NA | 1.36E-07 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401725165 | NA | 5.68E-09 | mr1545 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401725165 | NA | 4.20E-06 | mr1774 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401725165 | NA | 3.58E-07 | mr1931 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401725165 | NA | 1.98E-06 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401725165 | NA | 8.48E-07 | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |