\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401723023:

Variant ID: vg0401723023 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 1723023
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.64, C: 0.36, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:


GGGTCTGTTTAGTTCACGTTTAGTTCACGTTAAAATTGAAAGTTTGATTGAAATTGGAACGATGTGATGGAAAAGTTGGAAGTTTGTGTGTAGGAAAGTT[C/T]
TGATGTGATGGAAAAGTTAAAAGTTTGAAGAAAAAGTTTGAAACTAAACAAGGGCTTAATTGCGTTATGTCGACAAAACTCGTTGACTTGCTAATAGACT

Reverse complement sequence

AGTCTATTAGCAAGTCAACGAGTTTTGTCGACATAACGCAATTAAGCCCTTGTTTAGTTTCAAACTTTTTCTTCAAACTTTTAACTTTTCCATCACATCA[G/A]
AACTTTCCTACACACAAACTTCCAACTTTTCCATCACATCGTTCCAATTTCAATCAAACTTTCAATTTTAACGTGAACTAAACGTGAACTAAACAGACCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.30% 18.90% 0.55% 36.23% NA
All Indica  2759 52.20% 3.00% 0.51% 44.36% NA
All Japonica  1512 33.10% 40.00% 0.66% 26.26% NA
Aus  269 38.70% 51.70% 0.00% 9.67% NA
Indica I  595 17.80% 2.00% 0.67% 79.50% NA
Indica II  465 74.60% 2.20% 0.43% 22.80% NA
Indica III  913 67.70% 2.10% 0.22% 30.01% NA
Indica Intermediate  786 46.80% 5.20% 0.76% 47.20% NA
Temperate Japonica  767 5.60% 65.20% 1.17% 28.03% NA
Tropical Japonica  504 64.50% 10.90% 0.20% 24.40% NA
Japonica Intermediate  241 54.80% 20.70% 0.00% 24.48% NA
VI/Aromatic  96 12.50% 49.00% 1.04% 37.50% NA
Intermediate  90 43.30% 23.30% 1.11% 32.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401723023 C -> DEL N N silent_mutation Average:41.934; most accessible tissue: Minghui63 young leaf, score: 78.054 N N N N
vg0401723023 C -> T LOC_Os04g03830.1 upstream_gene_variant ; 194.0bp to feature; MODIFIER silent_mutation Average:41.934; most accessible tissue: Minghui63 young leaf, score: 78.054 N N N N
vg0401723023 C -> T LOC_Os04g03810.1 downstream_gene_variant ; 2668.0bp to feature; MODIFIER silent_mutation Average:41.934; most accessible tissue: Minghui63 young leaf, score: 78.054 N N N N
vg0401723023 C -> T LOC_Os04g03820.1 downstream_gene_variant ; 1317.0bp to feature; MODIFIER silent_mutation Average:41.934; most accessible tissue: Minghui63 young leaf, score: 78.054 N N N N
vg0401723023 C -> T LOC_Os04g03820-LOC_Os04g03830 intergenic_region ; MODIFIER silent_mutation Average:41.934; most accessible tissue: Minghui63 young leaf, score: 78.054 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401723023 NA 3.22E-07 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401723023 NA 1.12E-07 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401723023 NA 7.83E-07 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401723023 NA 2.03E-06 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401723023 NA 4.33E-06 mr1358 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401723023 NA 9.60E-09 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401723023 NA 3.17E-06 mr1520 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401723023 NA 7.04E-06 mr1555 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401723023 NA 5.98E-07 mr1614 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401723023 NA 3.82E-06 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401723023 NA 2.21E-06 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401723023 NA 2.00E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401723023 NA 1.83E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401723023 NA 2.37E-07 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401723023 NA 1.80E-06 mr1937 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401723023 NA 5.57E-07 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401723023 NA 4.95E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401723023 NA 3.75E-06 mr1092_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401723023 NA 7.12E-07 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401723023 NA 3.76E-16 mr1147_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401723023 NA 1.40E-06 mr1154_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401723023 NA 6.72E-07 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401723023 NA 9.17E-07 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401723023 NA 5.27E-06 mr1204_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401723023 NA 6.39E-06 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401723023 NA 2.78E-07 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401723023 5.35E-06 NA mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401723023 NA 7.94E-06 mr1220_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401723023 4.57E-06 1.16E-08 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401723023 NA 7.07E-09 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401723023 NA 7.30E-07 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401723023 1.24E-06 5.20E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401723023 NA 1.69E-08 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401723023 NA 1.40E-06 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401723023 NA 6.20E-09 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401723023 NA 6.18E-11 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401723023 NA 5.60E-07 mr1596_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401723023 NA 5.41E-07 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401723023 NA 1.96E-07 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401723023 NA 5.51E-06 mr1638_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401723023 NA 9.56E-06 mr1693_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401723023 NA 9.80E-06 mr1729_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401723023 NA 4.48E-06 mr1751_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401723023 NA 1.93E-07 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401723023 NA 1.40E-10 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401723023 NA 8.30E-06 mr1844_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401723023 NA 2.98E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401723023 NA 1.24E-08 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401723023 NA 5.51E-06 mr1896_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251