\
| Variant ID: vg0401713889 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 1713889 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.75, T: 0.25, others allele: 0.00, population size: 65. )
TTAGATGGCTATTCACAAAACTATGTTAAGTATTGCATGTGTGCATAATAGGTGGGGCCAAAACTTGTCAAACAAATAAGTTGTAACTTTCTGATAAAAT[C/T]
GTACTCTCTCTGTCCCACAAATAGGTAATCCTAGTATCCCAAAGTAAAATTTAAGGAGAGGATAAGTGACCAAACTACCTCTTATTATTAGTAAATTAGT
ACTAATTTACTAATAATAAGAGGTAGTTTGGTCACTTATCCTCTCCTTAAATTTTACTTTGGGATACTAGGATTACCTATTTGTGGGACAGAGAGAGTAC[G/A]
ATTTTATCAGAAAGTTACAACTTATTTGTTTGACAAGTTTTGGCCCCACCTATTATGCACACATGCAATACTTAACATAGTTTTGTGAATAGCCATCTAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.10% | 31.80% | 1.21% | 1.93% | NA |
| All Indica | 2759 | 86.60% | 8.40% | 1.70% | 3.26% | NA |
| All Japonica | 1512 | 27.70% | 71.60% | 0.66% | 0.00% | NA |
| Aus | 269 | 48.70% | 51.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 79.80% | 12.90% | 3.36% | 3.87% | NA |
| Indica II | 465 | 92.90% | 4.70% | 1.08% | 1.29% | NA |
| Indica III | 913 | 91.90% | 3.50% | 0.99% | 3.61% | NA |
| Indica Intermediate | 786 | 81.80% | 13.00% | 1.65% | 3.56% | NA |
| Temperate Japonica | 767 | 28.00% | 70.90% | 1.04% | 0.00% | NA |
| Tropical Japonica | 504 | 28.60% | 71.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 24.90% | 74.70% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 84.40% | 15.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 37.80% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0401713889 | C -> DEL | N | N | silent_mutation | Average:30.609; most accessible tissue: Callus, score: 53.182 | N | N | N | N |
| vg0401713889 | C -> T | LOC_Os04g03810.1 | upstream_gene_variant ; 763.0bp to feature; MODIFIER | silent_mutation | Average:30.609; most accessible tissue: Callus, score: 53.182 | N | N | N | N |
| vg0401713889 | C -> T | LOC_Os04g03796.1 | downstream_gene_variant ; 3370.0bp to feature; MODIFIER | silent_mutation | Average:30.609; most accessible tissue: Callus, score: 53.182 | N | N | N | N |
| vg0401713889 | C -> T | LOC_Os04g03796.2 | downstream_gene_variant ; 3370.0bp to feature; MODIFIER | silent_mutation | Average:30.609; most accessible tissue: Callus, score: 53.182 | N | N | N | N |
| vg0401713889 | C -> T | LOC_Os04g03796-LOC_Os04g03810 | intergenic_region ; MODIFIER | silent_mutation | Average:30.609; most accessible tissue: Callus, score: 53.182 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0401713889 | 3.48E-06 | NA | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401713889 | 8.55E-07 | 6.22E-08 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401713889 | 9.31E-08 | 2.07E-09 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401713889 | NA | 3.71E-07 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401713889 | NA | 2.56E-10 | mr1819 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401713889 | 4.27E-08 | NA | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401713889 | 4.44E-10 | 2.08E-11 | mr1038_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401713889 | 3.61E-10 | 2.09E-11 | mr1389_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401713889 | NA | 3.70E-06 | mr1754_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401713889 | NA | 1.43E-08 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401713889 | NA | 9.41E-06 | mr1982_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |