\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401713889:

Variant ID: vg0401713889 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 1713889
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.75, T: 0.25, others allele: 0.00, population size: 65. )

Flanking Sequence (100 bp) in Reference Genome:


TTAGATGGCTATTCACAAAACTATGTTAAGTATTGCATGTGTGCATAATAGGTGGGGCCAAAACTTGTCAAACAAATAAGTTGTAACTTTCTGATAAAAT[C/T]
GTACTCTCTCTGTCCCACAAATAGGTAATCCTAGTATCCCAAAGTAAAATTTAAGGAGAGGATAAGTGACCAAACTACCTCTTATTATTAGTAAATTAGT

Reverse complement sequence

ACTAATTTACTAATAATAAGAGGTAGTTTGGTCACTTATCCTCTCCTTAAATTTTACTTTGGGATACTAGGATTACCTATTTGTGGGACAGAGAGAGTAC[G/A]
ATTTTATCAGAAAGTTACAACTTATTTGTTTGACAAGTTTTGGCCCCACCTATTATGCACACATGCAATACTTAACATAGTTTTGTGAATAGCCATCTAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.10% 31.80% 1.21% 1.93% NA
All Indica  2759 86.60% 8.40% 1.70% 3.26% NA
All Japonica  1512 27.70% 71.60% 0.66% 0.00% NA
Aus  269 48.70% 51.30% 0.00% 0.00% NA
Indica I  595 79.80% 12.90% 3.36% 3.87% NA
Indica II  465 92.90% 4.70% 1.08% 1.29% NA
Indica III  913 91.90% 3.50% 0.99% 3.61% NA
Indica Intermediate  786 81.80% 13.00% 1.65% 3.56% NA
Temperate Japonica  767 28.00% 70.90% 1.04% 0.00% NA
Tropical Japonica  504 28.60% 71.20% 0.20% 0.00% NA
Japonica Intermediate  241 24.90% 74.70% 0.41% 0.00% NA
VI/Aromatic  96 84.40% 15.60% 0.00% 0.00% NA
Intermediate  90 61.10% 37.80% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401713889 C -> DEL N N silent_mutation Average:30.609; most accessible tissue: Callus, score: 53.182 N N N N
vg0401713889 C -> T LOC_Os04g03810.1 upstream_gene_variant ; 763.0bp to feature; MODIFIER silent_mutation Average:30.609; most accessible tissue: Callus, score: 53.182 N N N N
vg0401713889 C -> T LOC_Os04g03796.1 downstream_gene_variant ; 3370.0bp to feature; MODIFIER silent_mutation Average:30.609; most accessible tissue: Callus, score: 53.182 N N N N
vg0401713889 C -> T LOC_Os04g03796.2 downstream_gene_variant ; 3370.0bp to feature; MODIFIER silent_mutation Average:30.609; most accessible tissue: Callus, score: 53.182 N N N N
vg0401713889 C -> T LOC_Os04g03796-LOC_Os04g03810 intergenic_region ; MODIFIER silent_mutation Average:30.609; most accessible tissue: Callus, score: 53.182 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401713889 3.48E-06 NA mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401713889 8.55E-07 6.22E-08 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401713889 9.31E-08 2.07E-09 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401713889 NA 3.71E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401713889 NA 2.56E-10 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401713889 4.27E-08 NA mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401713889 4.44E-10 2.08E-11 mr1038_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401713889 3.61E-10 2.09E-11 mr1389_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401713889 NA 3.70E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401713889 NA 1.43E-08 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401713889 NA 9.41E-06 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251