\
| Variant ID: vg0401709039 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 1709039 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, others allele: 0.00, population size: 53. )
AAGTAACTGAAAAACGGAAATTAAGGAAGCGCATAAGTGTCAGGAGGTAAAATAATTGAGAAACTGAAAATATAGTAAGATCTCTTTCAGAGCACATACT[C/T]
TATACAAGGCCTGAGAAGAGCATACCGATAAGAGCCAGTAAATTCTGTCAAGGTGGTCAGTTTAATCACATATACATATTTTCCCTTTTGTGACTTAGGA
TCCTAAGTCACAAAAGGGAAAATATGTATATGTGATTAAACTGACCACCTTGACAGAATTTACTGGCTCTTATCGGTATGCTCTTCTCAGGCCTTGTATA[G/A]
AGTATGTGCTCTGAAAGAGATCTTACTATATTTTCAGTTTCTCAATTATTTTACCTCCTGACACTTATGCGCTTCCTTAATTTCCGTTTTTCAGTTACTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 42.30% | 32.70% | 2.12% | 22.89% | NA |
| All Indica | 2759 | 60.10% | 14.90% | 2.03% | 22.98% | NA |
| All Japonica | 1512 | 11.90% | 64.10% | 1.85% | 22.16% | NA |
| Aus | 269 | 31.60% | 44.20% | 3.72% | 20.45% | NA |
| Indica I | 595 | 61.00% | 31.60% | 2.52% | 4.87% | NA |
| Indica II | 465 | 47.50% | 10.80% | 3.01% | 38.71% | NA |
| Indica III | 913 | 71.20% | 3.00% | 1.53% | 24.32% | NA |
| Indica Intermediate | 786 | 53.80% | 18.70% | 1.65% | 25.83% | NA |
| Temperate Japonica | 767 | 10.70% | 74.80% | 0.78% | 13.69% | NA |
| Tropical Japonica | 504 | 16.30% | 49.60% | 3.57% | 30.56% | NA |
| Japonica Intermediate | 241 | 6.60% | 60.20% | 1.66% | 31.54% | NA |
| VI/Aromatic | 96 | 47.90% | 11.50% | 4.17% | 36.46% | NA |
| Intermediate | 90 | 32.20% | 40.00% | 2.22% | 25.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0401709039 | C -> DEL | N | N | silent_mutation | Average:36.258; most accessible tissue: Callus, score: 78.812 | N | N | N | N |
| vg0401709039 | C -> T | LOC_Os04g03796.4 | downstream_gene_variant ; 2375.0bp to feature; MODIFIER | silent_mutation | Average:36.258; most accessible tissue: Callus, score: 78.812 | N | N | N | N |
| vg0401709039 | C -> T | LOC_Os04g03796.1 | intron_variant ; MODIFIER | silent_mutation | Average:36.258; most accessible tissue: Callus, score: 78.812 | N | N | N | N |
| vg0401709039 | C -> T | LOC_Os04g03796.2 | intron_variant ; MODIFIER | silent_mutation | Average:36.258; most accessible tissue: Callus, score: 78.812 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0401709039 | 2.94E-06 | NA | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401709039 | NA | 1.87E-06 | mr1761 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401709039 | 1.21E-07 | NA | mr1038_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401709039 | 1.22E-06 | 4.67E-07 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401709039 | NA | 7.86E-06 | mr1053_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401709039 | NA | 4.43E-09 | mr1322_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401709039 | NA | 3.57E-06 | mr1329_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401709039 | 2.94E-06 | 3.07E-06 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401709039 | NA | 9.67E-09 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401709039 | NA | 4.19E-06 | mr1982_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |