\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401709039:

Variant ID: vg0401709039 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 1709039
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:


AAGTAACTGAAAAACGGAAATTAAGGAAGCGCATAAGTGTCAGGAGGTAAAATAATTGAGAAACTGAAAATATAGTAAGATCTCTTTCAGAGCACATACT[C/T]
TATACAAGGCCTGAGAAGAGCATACCGATAAGAGCCAGTAAATTCTGTCAAGGTGGTCAGTTTAATCACATATACATATTTTCCCTTTTGTGACTTAGGA

Reverse complement sequence

TCCTAAGTCACAAAAGGGAAAATATGTATATGTGATTAAACTGACCACCTTGACAGAATTTACTGGCTCTTATCGGTATGCTCTTCTCAGGCCTTGTATA[G/A]
AGTATGTGCTCTGAAAGAGATCTTACTATATTTTCAGTTTCTCAATTATTTTACCTCCTGACACTTATGCGCTTCCTTAATTTCCGTTTTTCAGTTACTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.30% 32.70% 2.12% 22.89% NA
All Indica  2759 60.10% 14.90% 2.03% 22.98% NA
All Japonica  1512 11.90% 64.10% 1.85% 22.16% NA
Aus  269 31.60% 44.20% 3.72% 20.45% NA
Indica I  595 61.00% 31.60% 2.52% 4.87% NA
Indica II  465 47.50% 10.80% 3.01% 38.71% NA
Indica III  913 71.20% 3.00% 1.53% 24.32% NA
Indica Intermediate  786 53.80% 18.70% 1.65% 25.83% NA
Temperate Japonica  767 10.70% 74.80% 0.78% 13.69% NA
Tropical Japonica  504 16.30% 49.60% 3.57% 30.56% NA
Japonica Intermediate  241 6.60% 60.20% 1.66% 31.54% NA
VI/Aromatic  96 47.90% 11.50% 4.17% 36.46% NA
Intermediate  90 32.20% 40.00% 2.22% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401709039 C -> DEL N N silent_mutation Average:36.258; most accessible tissue: Callus, score: 78.812 N N N N
vg0401709039 C -> T LOC_Os04g03796.4 downstream_gene_variant ; 2375.0bp to feature; MODIFIER silent_mutation Average:36.258; most accessible tissue: Callus, score: 78.812 N N N N
vg0401709039 C -> T LOC_Os04g03796.1 intron_variant ; MODIFIER silent_mutation Average:36.258; most accessible tissue: Callus, score: 78.812 N N N N
vg0401709039 C -> T LOC_Os04g03796.2 intron_variant ; MODIFIER silent_mutation Average:36.258; most accessible tissue: Callus, score: 78.812 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401709039 2.94E-06 NA mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401709039 NA 1.87E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401709039 1.21E-07 NA mr1038_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401709039 1.22E-06 4.67E-07 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401709039 NA 7.86E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401709039 NA 4.43E-09 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401709039 NA 3.57E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401709039 2.94E-06 3.07E-06 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401709039 NA 9.67E-09 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401709039 NA 4.19E-06 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251