\
| Variant ID: vg0401706334 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 1706334 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.62, A: 0.38, others allele: 0.00, population size: 78. )
AAGCATTTTGCATCCGTTGCATACAACTCGTAGCCAGGATTTCCTCGGATTGGACTACACCCAATCAGCTGGTTTACTGCATGATACAAACTATGGAGAC[A/G]
GCGTCATCATTGGAATTATCGATTCAGGTAACTACACTTCCTCATGTTTGATATGTATTCCATCAGGTTCTATACACTAGCTAAATACATTTTAACAGTA
TACTGTTAAAATGTATTTAGCTAGTGTATAGAACCTGATGGAATACATATCAAACATGAGGAAGTGTAGTTACCTGAATCGATAATTCCAATGATGACGC[T/C]
GTCTCCATAGTTTGTATCATGCAGTAAACCAGCTGATTGGGTGTAGTCCAATCCGAGGAAATCCTGGCTACGAGTTGTATGCAACGGATGCAAAATGCTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.50% | 23.40% | 0.66% | 13.44% | NA |
| All Indica | 2759 | 85.80% | 9.30% | 0.94% | 3.99% | NA |
| All Japonica | 1512 | 21.90% | 50.70% | 0.20% | 27.25% | NA |
| Aus | 269 | 45.00% | 21.20% | 0.74% | 33.09% | NA |
| Indica I | 595 | 76.00% | 21.20% | 1.51% | 1.34% | NA |
| Indica II | 465 | 88.60% | 8.20% | 1.29% | 1.94% | NA |
| Indica III | 913 | 94.50% | 0.90% | 0.33% | 4.27% | NA |
| Indica Intermediate | 786 | 81.40% | 10.70% | 1.02% | 6.87% | NA |
| Temperate Japonica | 767 | 23.10% | 72.40% | 0.26% | 4.30% | NA |
| Tropical Japonica | 504 | 25.60% | 24.20% | 0.20% | 50.00% | NA |
| Japonica Intermediate | 241 | 10.40% | 36.90% | 0.00% | 52.70% | NA |
| VI/Aromatic | 96 | 86.50% | 4.20% | 0.00% | 9.38% | NA |
| Intermediate | 90 | 56.70% | 26.70% | 0.00% | 16.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0401706334 | A -> DEL | LOC_Os04g03796.1 | N | frameshift_variant | Average:50.303; most accessible tissue: Minghui63 flag leaf, score: 72.472 | N | N | N | N |
| vg0401706334 | A -> DEL | LOC_Os04g03796.4 | N | frameshift_variant | Average:50.303; most accessible tissue: Minghui63 flag leaf, score: 72.472 | N | N | N | N |
| vg0401706334 | A -> G | LOC_Os04g03796.1 | missense_variant ; p.Ser178Gly; MODERATE | nonsynonymous_codon ; S178G | Average:50.303; most accessible tissue: Minghui63 flag leaf, score: 72.472 | benign |
-0.403 |
TOLERATED | 0.90 |
| vg0401706334 | A -> G | LOC_Os04g03796.4 | missense_variant ; p.Ser145Gly; MODERATE | nonsynonymous_codon ; S145G | Average:50.303; most accessible tissue: Minghui63 flag leaf, score: 72.472 | benign |
-0.398 |
TOLERATED | 0.84 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0401706334 | NA | 9.20E-06 | mr1028 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401706334 | NA | 3.95E-06 | mr1245 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401706334 | NA | 2.38E-07 | mr1648 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401706334 | NA | 3.44E-06 | mr1652 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401706334 | 8.50E-06 | 5.02E-07 | mr1683 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401706334 | 3.25E-06 | 2.55E-09 | mr1697 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401706334 | NA | 3.42E-06 | mr1715 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401706334 | NA | 6.58E-06 | mr1921 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401706334 | NA | 6.48E-08 | mr1062_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |