\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401701856:

Variant ID: vg0401701856 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 1701856
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGTATAGCATCATCGAGAAGGATCACGCCAGTGTAAGCAGTCGCCATTGCACATCGCTGTTGGTCCTCAATTGGTGGGAAAAATTACTAAATAGCAAGT[A/T]
GCTAGATATCCAAGTCAGGAAGCATTACACACACTGCACCTACCGGGTAATTTAATTTCCCTGAATCCGTGTCCTCCATCGTCTACCTCGCTCGCAACAA

Reverse complement sequence

TTGTTGCGAGCGAGGTAGACGATGGAGGACACGGATTCAGGGAAATTAAATTACCCGGTAGGTGCAGTGTGTGTAATGCTTCCTGACTTGGATATCTAGC[T/A]
ACTTGCTATTTAGTAATTTTTCCCACCAATTGAGGACCAACAGCGATGTGCAATGGCGACTGCTTACACTGGCGTGATCCTTCTCGATGATGCTATACAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.30% 14.70% 0.57% 35.40% NA
All Indica  2759 49.40% 3.30% 0.54% 46.76% NA
All Japonica  1512 53.60% 29.60% 0.53% 16.20% NA
Aus  269 12.30% 48.30% 1.12% 38.29% NA
Indica I  595 40.80% 0.70% 1.01% 57.48% NA
Indica II  465 76.80% 1.90% 0.22% 21.08% NA
Indica III  913 42.80% 2.80% 0.33% 54.00% NA
Indica Intermediate  786 47.20% 6.70% 0.64% 45.42% NA
Temperate Japonica  767 82.80% 4.60% 0.26% 12.39% NA
Tropical Japonica  504 21.40% 57.50% 0.99% 20.04% NA
Japonica Intermediate  241 28.20% 51.00% 0.41% 20.33% NA
VI/Aromatic  96 76.00% 12.50% 1.04% 10.42% NA
Intermediate  90 55.60% 16.70% 0.00% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401701856 A -> DEL N N silent_mutation Average:57.955; most accessible tissue: Callus, score: 84.185 N N N N
vg0401701856 A -> T LOC_Os04g03796.1 upstream_gene_variant ; 147.0bp to feature; MODIFIER silent_mutation Average:57.955; most accessible tissue: Callus, score: 84.185 N N N N
vg0401701856 A -> T LOC_Os04g03796.3 upstream_gene_variant ; 147.0bp to feature; MODIFIER silent_mutation Average:57.955; most accessible tissue: Callus, score: 84.185 N N N N
vg0401701856 A -> T LOC_Os04g03796.4 upstream_gene_variant ; 147.0bp to feature; MODIFIER silent_mutation Average:57.955; most accessible tissue: Callus, score: 84.185 N N N N
vg0401701856 A -> T LOC_Os04g03796.2 upstream_gene_variant ; 3533.0bp to feature; MODIFIER silent_mutation Average:57.955; most accessible tissue: Callus, score: 84.185 N N N N
vg0401701856 A -> T LOC_Os04g03790-LOC_Os04g03796 intergenic_region ; MODIFIER silent_mutation Average:57.955; most accessible tissue: Callus, score: 84.185 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0401701856 A T 0.26 0.05 0.0 -0.02 0.03 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401701856 NA 9.50E-08 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401701856 NA 6.56E-08 mr1800 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401701856 NA 9.98E-06 mr1544_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401701856 2.16E-07 NA mr1549_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401701856 NA 9.75E-06 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401701856 NA 3.16E-08 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251