Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0401701280:

Variant ID: vg0401701280 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 1701280
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAAATCTTTTAGGGATACAATTTAGAAATATTTTAAATCTTCACTAAAAATAAATAAAGGGATAGGGAAGAGCACATACCTTTTGCTTATGTTAAATGGA[G/A]
GCTTTTTGAGGAGCCCCATATTAATCCTATAAGGTGAAGATAGCTAAAAAATTCTCATGTTAATTGAAAATTCTTAGAATTCACATGTTAATTGAAGAAA

Reverse complement sequence

TTTCTTCAATTAACATGTGAATTCTAAGAATTTTCAATTAACATGAGAATTTTTTAGCTATCTTCACCTTATAGGATTAATATGGGGCTCCTCAAAAAGC[C/T]
TCCATTTAACATAAGCAAAAGGTATGTGCTCTTCCCTATCCCTTTATTTATTTTTAGTGAAGATTTAAAATATTTCTAAATTGTATCCCTAAAAGATTTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.50%	16.40%	0.49%	35.67%	NA
All Indica	2759	46.60%	5.70%	0.69%	47.01%	NA
All Japonica	1512	53.60%	29.90%	0.20%	16.27%	NA
Aus	269	11.50%	48.70%	0.00%	39.78%	NA
Indica I	595	32.10%	8.10%	1.51%	58.32%	NA
Indica II	465	76.10%	2.60%	0.43%	20.86%	NA
Indica III	913	42.80%	3.00%	0.11%	54.11%	NA
Indica Intermediate	786	44.40%	9.00%	0.89%	45.67%	NA
Temperate Japonica	767	82.80%	4.60%	0.13%	12.52%	NA
Tropical Japonica	504	21.40%	58.30%	0.20%	20.04%	NA
Japonica Intermediate	241	28.20%	51.00%	0.41%	20.33%	NA
VI/Aromatic	96	75.00%	14.60%	0.00%	10.42%	NA
Intermediate	90	48.90%	21.10%	1.11%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0401701280	G -> DEL	N	N	silent_mutation	Average:26.018; most accessible tissue: Callus, score: 59.377	N	N	N	N
vg0401701280	G -> A	LOC_Os04g03790.1	upstream_gene_variant ; 4975.0bp to feature; MODIFIER	silent_mutation	Average:26.018; most accessible tissue: Callus, score: 59.377	N	N	N	N
vg0401701280	G -> A	LOC_Os04g03796.1	upstream_gene_variant ; 723.0bp to feature; MODIFIER	silent_mutation	Average:26.018; most accessible tissue: Callus, score: 59.377	N	N	N	N
vg0401701280	G -> A	LOC_Os04g03796.3	upstream_gene_variant ; 723.0bp to feature; MODIFIER	silent_mutation	Average:26.018; most accessible tissue: Callus, score: 59.377	N	N	N	N
vg0401701280	G -> A	LOC_Os04g03796.4	upstream_gene_variant ; 723.0bp to feature; MODIFIER	silent_mutation	Average:26.018; most accessible tissue: Callus, score: 59.377	N	N	N	N
vg0401701280	G -> A	LOC_Os04g03796.2	upstream_gene_variant ; 4109.0bp to feature; MODIFIER	silent_mutation	Average:26.018; most accessible tissue: Callus, score: 59.377	N	N	N	N
vg0401701280	G -> A	LOC_Os04g03790-LOC_Os04g03796	intergenic_region ; MODIFIER	silent_mutation	Average:26.018; most accessible tissue: Callus, score: 59.377	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0401701280	5.66E-07	NA	mr1549	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401701280	NA	9.38E-09	mr1666	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401701280	NA	4.14E-10	mr1696	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401701280	NA	2.28E-08	mr1800	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401701280	NA	5.72E-06	mr1852	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401701280	1.31E-08	NA	mr1549_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401701280	3.86E-06	NA	mr1757_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401701280	NA	2.24E-07	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251