\
| Variant ID: vg0401672885 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 1672885 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GCCCATTTGATCAAATTCCAGGAAAAACCATCACCTCTAAACCCCTCATAGGTAATCCTTGCTTTTTAATTTACCCCTAAACACTTCCTATTATACTTGA[T/C]
ATTCTTTTAACTTTTTCCTTCAGATTTAATTGGGGTAGTCAGTCGTATTGGTCCATATGATTTCGCGAGCCCAACATCAGACAAAAAACTCAGAAGAATT
AATTCTTCTGAGTTTTTTGTCTGATGTTGGGCTCGCGAAATCATATGGACCAATACGACTGACTACCCCAATTAAATCTGAAGGAAAAAGTTAAAAGAAT[A/G]
TCAAGTATAATAGGAAGTGTTTAGGGGTAAATTAAAAAGCAAGGATTACCTATGAGGGGTTTAGAGGTGATGGTTTTTCCTGGAATTTGATCAAATGGGC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.00% | 1.60% | 2.09% | 59.27% | NA |
| All Indica | 2759 | 29.50% | 1.80% | 2.50% | 66.15% | NA |
| All Japonica | 1512 | 54.30% | 1.60% | 1.79% | 42.33% | NA |
| Aus | 269 | 13.00% | 0.40% | 0.00% | 86.62% | NA |
| Indica I | 595 | 35.50% | 1.50% | 2.18% | 60.84% | NA |
| Indica II | 465 | 51.60% | 1.10% | 2.37% | 44.95% | NA |
| Indica III | 913 | 9.00% | 2.60% | 2.96% | 85.43% | NA |
| Indica Intermediate | 786 | 35.90% | 1.50% | 2.29% | 60.31% | NA |
| Temperate Japonica | 767 | 84.20% | 0.30% | 0.00% | 15.51% | NA |
| Tropical Japonica | 504 | 20.80% | 3.40% | 5.36% | 70.44% | NA |
| Japonica Intermediate | 241 | 29.00% | 2.10% | 0.00% | 68.88% | NA |
| VI/Aromatic | 96 | 35.40% | 1.00% | 2.08% | 61.46% | NA |
| Intermediate | 90 | 48.90% | 1.10% | 1.11% | 48.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0401672885 | T -> C | LOC_Os04g03760.1 | downstream_gene_variant ; 3724.0bp to feature; MODIFIER | silent_mutation | Average:6.0; most accessible tissue: Callus, score: 21.328 | N | N | N | N |
| vg0401672885 | T -> C | LOC_Os04g03740-LOC_Os04g03760 | intergenic_region ; MODIFIER | silent_mutation | Average:6.0; most accessible tissue: Callus, score: 21.328 | N | N | N | N |
| vg0401672885 | T -> DEL | N | N | silent_mutation | Average:6.0; most accessible tissue: Callus, score: 21.328 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0401672885 | NA | 1.25E-07 | mr1346_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401672885 | NA | 4.54E-06 | mr1577_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401672885 | NA | 3.73E-06 | mr1686_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401672885 | NA | 3.52E-08 | mr1780_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401672885 | NA | 1.63E-07 | mr1792_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |