\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401647321:

Variant ID: vg0401647321 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 1647321
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGGGCATACCAGTTGTGTACTCAGCTGGGAATGATGGACCCATCACTCAGACGGTGGAAAACTCATCGCCATGGCTGCTAACTGTTACTGCAGCCACTAT[G/T]
GATCGGTCATTCCCTGTGGTTATCACATTGGGAAATAATGACAAATTTGTGGTATATATATTTATTTACTGTTCAGTTTTCTATTTATAACACAATCTGT

Reverse complement sequence

ACAGATTGTGTTATAAATAGAAAACTGAACAGTAAATAAATATATATACCACAAATTTGTCATTATTTCCCAATGTGATAACCACAGGGAATGACCGATC[C/A]
ATAGTGGCTGCAGTAACAGTTAGCAGCCATGGCGATGAGTTTTCCACCGTCTGAGTGATGGGTCCATCATTCCCAGCTGAGTACACAACTGGTATGCCCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.90% 34.40% 0.97% 28.73% NA
All Indica  2759 27.60% 49.10% 0.94% 22.33% NA
All Japonica  1512 54.10% 8.20% 0.86% 36.84% NA
Aus  269 11.90% 42.00% 0.74% 45.35% NA
Indica I  595 31.30% 58.50% 1.18% 9.08% NA
Indica II  465 48.80% 23.70% 1.29% 26.24% NA
Indica III  913 9.10% 57.20% 0.88% 32.86% NA
Indica Intermediate  786 33.80% 47.70% 0.64% 17.81% NA
Temperate Japonica  767 84.40% 4.70% 0.78% 10.17% NA
Tropical Japonica  504 20.20% 7.90% 1.19% 70.63% NA
Japonica Intermediate  241 28.60% 19.90% 0.41% 51.04% NA
VI/Aromatic  96 40.60% 11.50% 1.04% 46.88% NA
Intermediate  90 48.90% 26.70% 4.44% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401647321 G -> DEL LOC_Os04g03710.1 N frameshift_variant Average:42.11; most accessible tissue: Zhenshan97 flag leaf, score: 81.605 N N N N
vg0401647321 G -> T LOC_Os04g03710.1 missense_variant ; p.Met1100Ile; MODERATE nonsynonymous_codon ; M1100I Average:42.11; most accessible tissue: Zhenshan97 flag leaf, score: 81.605 benign -0.277 DELETERIOUS 0.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0401647321 G T -0.05 -0.01 -0.03 -0.04 -0.04 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401647321 NA 3.02E-06 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401647321 NA 7.18E-06 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401647321 NA 1.23E-06 mr1084_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401647321 NA 9.33E-07 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401647321 NA 3.03E-06 mr1205_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401647321 NA 7.47E-07 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401647321 NA 7.04E-08 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401647321 NA 1.36E-07 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401647321 NA 6.63E-07 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401647321 6.42E-06 6.42E-06 mr1418_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401647321 NA 9.46E-06 mr1420_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401647321 NA 2.78E-07 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401647321 NA 3.09E-06 mr1488_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401647321 2.57E-06 2.57E-06 mr1506_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401647321 NA 3.98E-06 mr1550_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401647321 NA 8.39E-06 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401647321 NA 1.58E-06 mr1668_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401647321 NA 6.58E-07 mr1739_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401647321 NA 1.08E-06 mr1741_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401647321 NA 1.45E-06 mr1751_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401647321 NA 6.87E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401647321 NA 5.01E-08 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401647321 NA 6.78E-06 mr1896_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251