\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401647058:

Variant ID: vg0401647058 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 1647058
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.53, C: 0.47, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


TGGCCATGGCATGCACATGGCCTCGACAGCCGGTGGCAACATCGTTCACAATGCTAGCATTTTTGGTCTAGCTACCGGGACAGTTCGGGGTGGTGCGCCT[T/C]
GTGCACGAGTAGCCATGTACAAAGCTTGTTGGTCCGGGGGCGGGTGCTCAACCGCTGGCCAGTTGAAAGCTATGGATGATGCTGTCCATGATGGTGTTGA

Reverse complement sequence

TCAACACCATCATGGACAGCATCATCCATAGCTTTCAACTGGCCAGCGGTTGAGCACCCGCCCCCGGACCAACAAGCTTTGTACATGGCTACTCGTGCAC[A/G]
AGGCGCACCACCCCGAACTGTCCCGGTAGCTAGACCAAAAATGCTAGCATTGTGAACGATGTTGCCACCGGCTGTCGAGGCCATGTGCATGCCATGGCCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.90% 35.10% 0.63% 26.34% NA
All Indica  2759 49.50% 27.40% 0.80% 22.33% NA
All Japonica  1512 17.50% 53.00% 0.40% 29.17% NA
Aus  269 43.10% 10.80% 0.00% 46.10% NA
Indica I  595 57.80% 32.60% 0.50% 9.08% NA
Indica II  465 23.20% 49.90% 1.08% 25.81% NA
Indica III  913 58.70% 7.30% 0.66% 33.30% NA
Indica Intermediate  786 48.00% 33.50% 1.02% 17.56% NA
Temperate Japonica  767 13.60% 82.50% 0.26% 3.65% NA
Tropical Japonica  504 21.20% 19.60% 0.40% 58.73% NA
Japonica Intermediate  241 22.00% 28.60% 0.83% 48.55% NA
VI/Aromatic  96 16.70% 34.40% 1.04% 47.92% NA
Intermediate  90 35.60% 43.30% 1.11% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401647058 T -> C LOC_Os04g03710.1 missense_variant ; p.Cys1013Arg; MODERATE nonsynonymous_codon ; C1013R Average:46.072; most accessible tissue: Zhenshan97 flag leaf, score: 86.342 benign -0.569 DELETERIOUS 0.00
vg0401647058 T -> DEL LOC_Os04g03710.1 N frameshift_variant Average:46.072; most accessible tissue: Zhenshan97 flag leaf, score: 86.342 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0401647058 T C 0.03 -0.01 0.0 0.02 0.02 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401647058 NA 3.29E-06 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401647058 NA 7.83E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401647058 NA 6.53E-07 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401647058 NA 4.06E-09 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401647058 NA 4.87E-06 mr1751_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401647058 2.74E-06 2.74E-06 mr1934_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251